KIAA1214

Product ID	ORK00768
Accession No	AB033040
Description	ring finger protein 150
Clone name	fh01431
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5111 bp) Predicted protein sequence (462 aa)
HaloTag ORF Clone	FHC00768
Flexi ORF Clone	FXC00768
Source	Human fetal brain
Rouge ID	mKIAA1214 by Kazusa Mouse cDNA Project

Length: 5111 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3266 bp
Genome contig ID	gi89161207r_141906175
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTTCTGGAGGATTTTCCTGTAGCTTTGATAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGAAAAAAAAAAAGCTTAACCAGAAAGTTTCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	142006175	142274066	8	100.0	Internal No-hit

Length: 462 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX05090	8.1e-150	100.0	ring finger pro...	Homo sapiens
Q9ULK6	2.3e-72	90.4	RING finger pro...	Homo sapiens
BAC85369	4.9e-69	84.5	unnamed protein...	Homo sapiens
XP_001502278	6.5e-67	87.5	ring finger pro...	Equus caballus
XP_871924	1.3e-66	78.6	similar to RING...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051436	1.7e-07	26.1	KIAA1133
AB029023	1.4e-05	34.4	KIAA1100
AB014575	0.00028	38.9	KIAA0675
AB007898	0.00049	31.4	KIAA0438
AB058713	0.00066	28.6	KIAA1810

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003137	147	249	PF02225	Protease-associated PA
HMMPfam	IPR001841	302	342	PF00097	Zinc finger
HMMSmart	IPR001841	302	342	SM00184	Zinc finger
ProfileScan	IPR001841	302	343	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	72	IQACCSLALSTWLLSFCFVHLLC	94	PRIMARY	23

Primer_f	CCAAGAACTAGGTGAATCAGG
Primer_r	AGTAGTGAATGGCAAAGGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-