KIAA1307

Product ID	ORK07275
Accession No	AB037728
Description	ubiquitin protein ligase E3 component n-recognin 4
Clone name	fh08302
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5601 bp) Predicted protein sequence (1678 aa)
Source	Human fetal brain

Length: 5601 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	564 bp
Genome contig ID	gi89161185r_19250005
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- ATATATACACGATTAAAGTGCTGCAAATATCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGATAAAGTTTCTCTATGTCTATAAAATTGACGTGATTTACTTCTTTGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	19350005	19378151	31	100.0	Perfect prediction

Length: 1678 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI19269	100.0	ubiquitin prote...	Homo sapiens
EAW94868	100.0	zinc finger, UB...	Homo sapiens
Q5T4S7	99.0	E3 ubiquitin-pr...	Homo sapiens
AAL83880	99.0	p600 [Homo sapi...	Homo sapiens
XP_513158	98.8	retinoblastoma-...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020703	3.2e-06	25.3	KIAA0896

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003126	882	950	PF02207	Zinc finger
HMMSmart	IPR013993	882	950	SM00396	Zinc finger
ProfileScan	IPR003126	878	951	PS51157	Zinc finger
ScanRegExp	IPR007087	880	902	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	69	QMRFVPLILARLLLIFDYLLHQY	91	PRIMARY	23

Primer_f	TGGGACTCAAGCAATAGAACG
Primer_r	AGGGGAAGTCAAACCAGCGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGGGACTCAAGCAATAGAACG
Primer_r	AGGGGAAGTCAAACCAGCGTG
PCR product length	98 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles