KIAA0896

Product ID	ORK01677
Accession No	AB020703
Description	ubiquitin protein ligase E3 component n-recognin 5, transcript variant 2
Clone name	hk08890s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk08890s2 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (9250 bp) Predicted protein sequence (2820 aa)
HaloTag ORF Clone	FHC01677
Flexi ORF Clone	FXC01677
Source	Human adult brain
Rouge ID	mKIAA0896 by Kazusa Mouse cDNA Project
Note	We replaced hk08890 and hk08890s1, former representative clones for KIAA0896 with hk08890s2. (2002/5/10,2005/08/06)

Length: 9250 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	398 bp
Genome contig ID	gi51511724r_103235308
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGAATAGGGAATTTCAAAATAAAAAATTAAGTATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTCTGTGTTTTCATTTTAACTTTTTTTATGGTGTTTAATTTGTGGTTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	103335308	103494093	59	99.9	Perfect prediction

Length: 2820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10396	100.0	E3 ubiquitin-pr...	synthetic construct
EAW91843	99.9	E3 ubiquitin pr...	Homo sapiens
O95071	100.0	E3 ubiquitin-pr...	Homo sapiens
EAW91846	99.9	E3 ubiquitin pr...	Homo sapiens
XP_001100326	99.8	similar to E3 u...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037741	1.1e-11	32.0	KIAA1320
AB002310	3.1e-10	28.8	KIAA0312
AB002315	3.2e-10	28.3	KIAA0317
AB007899	1.6e-09	29.4	KIAA0439
AB046845	1.8e-09	28.2	KIAA1625

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003126	1199	1266	PF02207	Zinc finger
	IPR002004	2397	2471	PF00658	Polyadenylate-binding protein/Hyperplastic disc protein
	IPR000569	2507	2820	PF00632	HECT
HMMSmart	IPR013993	1199	1266	SM00396	Zinc finger
	IPR002004	2411	2474	SM00517	Polyadenylate-binding protein/Hyperplastic disc protein
	IPR000569	2454	2820	SM00119	HECT
ProfileScan	IPR003126	1199	1267	PS51157	Zinc finger
ProfileScan	IPR000569	2525	2820	PS50237	HECT

Primer_f	TTCCAGCCTATGCCCTCAATC
Primer_r	TTTAGAGGAATAGAGTGGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-