Gene/Protein Characteristic Table for KIAA0896
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01677
Accession No AB020703
Description ubiquitin protein ligase E3 component n-recognin 5, transcript variant 2
Clone name hk08890s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (9250 bp)
Predicted protein sequence (2820 aa)
Flexi ORF Clone FXC01677
Source Human adult brain
Rouge ID mKIAA0896 by Kazusa Mouse cDNA Project
Note We replaced hk08890 and hk08890s1, former representative clones for KIAA0896 with hk08890s2. (2002/5/10,2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 9250 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 398 bp
Genome contig ID gi51511724r_103235308
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GGAATAGGGAATTTCAAAATAAAAAATTAAGTATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTCTGTGTTTTCATTTTAACTTTTTTTATGGTGTTTAATTTGTGGTTGGC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 8 r 103335308 103494093 59 99.9 Perfect prediction
Features of the protein sequence
Description

Length: 2820 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10396 0 100.0 E3 ubiquitin-pr...
synthetic construct
EAW91843 0 99.9 E3 ubiquitin pr...
Homo sapiens
O95071 0 100.0 E3 ubiquitin-pr...
Homo sapiens
EAW91846 0 99.9 E3 ubiquitin pr...
Homo sapiens
XP_001100326 0 99.8 similar to E3 u...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037741 1.1e-11 32.0 KIAA1320
AB002310 3.1e-10 28.8 KIAA0312
AB002315 3.2e-10 28.3 KIAA0317
AB007899 1.6e-09 29.4 KIAA0439
AB046845 1.8e-09 28.2 KIAA1625
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003126 1199 1266 PF02207 Zinc finger
IPR002004 2397 2471 PF00658 Polyadenylate-binding protein/Hyperplastic disc protein
IPR000569 2507 2820 PF00632 HECT
HMMSmart IPR013993 1199 1266 SM00396 Zinc finger
IPR002004 2411 2474 SM00517 Polyadenylate-binding protein/Hyperplastic disc protein
IPR000569 2454 2820 SM00119 HECT
ProfileScan IPR003126 1199 1267 PS51157 Zinc finger
IPR000569 2525 2820 PS50237 HECT
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTCCAGCCTATGCCCTCAATC
Primer_r TTTAGAGGAATAGAGTGGGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 8
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp