Gene/Protein Characteristic Table for KIAA0317
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00503
Accession No AB002315
Description apoptosis resistant E3 ubiquitin protein ligase 1
Clone name hg00276
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5402 bp)
Predicted protein sequence (826 aa)
Flexi ORF Clone FXC00503
Source Human adult brain
Rouge ID mKIAA0317 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5402 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 826 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH60658 0 97.1 RIKEN cDNA 1110...
Mus musculus
BAE32654 0 97.1 unnamed protein...
Mus musculus
AAI18075 0 97.1 Hypothetical pr...
Bos taurus
BAE28198 0 96.7 unnamed protein...
Mus musculus
XP_001368000 0 94.8 similar to ReO_...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002310 3.9e-38 34.6 KIAA0312
AB007899 6.2e-31 31.0 KIAA0439
AB037741 8.8e-31 33.4 KIAA1320
D42055 1.6e-30 31.2 KIAA0093
D13635 3.5e-27 30.5 KIAA0010
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001298 71 158 PF00630 Filamin/ABP280 repeat
IPR000569 515 826 PF00632 HECT
HMMSmart IPR000569 484 826 SM00119 HECT
ProfileScan IPR001298 55 161 PS50194 Filamin/ABP280 repeat
IPR000569 486 826 PS50237 HECT
ScanRegExp IPR000408 182 192 PS00626 Regulator of chromosome condensation
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CATGTCTGGTCTCCTTCAAAG
Primer_r GTGGGGAAAAGGTACAATATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 14
Experimental conditions
Panel name GeneBridge 4
Primer_f CATGTCTGGTCTCCTTCAAAG
Primer_r GTGGGGAAAAGGTACAATATG
PCR product length 173 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp