Order Kazusa clone(s) from : ![]() |
Product ID | ORK00503 |
---|---|
Accession No | AB002315 |
Description | apoptosis resistant E3 ubiquitin protein ligase 1 |
Clone name | hg00276 |
Vector information | |
cDNA sequence | DNA sequence (5402 bp) Predicted protein sequence (826 aa) |
HaloTag ORF Clone |
FHC00503
![]() |
Flexi ORF Clone | FXC00503 |
Source | Human adult brain |
Rouge ID |
mKIAA0317
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001298 | 71 | 158 | PF00630 | Filamin/ABP280 repeat |
IPR000569 | 515 | 826 | PF00632 | HECT | |
HMMSmart | IPR000569 | 484 | 826 | SM00119 | HECT |
ProfileScan | IPR001298 | 55 | 161 | PS50194 | Filamin/ABP280 repeat |
IPR000569 | 486 | 826 | PS50237 | HECT | |
ScanRegExp | IPR000408 | 182 | 192 | PS00626 | Regulator of chromosome condensation |
![]() |
---|
Primer_f | CATGTCTGGTCTCCTTCAAAG |
---|---|
Primer_r | GTGGGGAAAAGGTACAATATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CATGTCTGGTCTCCTTCAAAG |
Primer_r | GTGGGGAAAAGGTACAATATG |
PCR product length | 173 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |