Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04789 |
---|---|
Accession No | AB033058 |
Description | discs, large homolog 3 (Drosophila) |
Clone name | fh08445 |
Vector information | |
cDNA sequence | DNA sequence (5072 bp) Predicted protein sequence (520 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1232
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3218 bp |
---|---|
Genome contig ID | gi89161218f_69488880 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (153184 - 153233) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 176 | 234 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 175 | 185 | PR00452 | Src homology-3 |
IPR001452 | 194 | 209 | PR00452 | Src homology-3 | |
IPR001452 | 211 | 220 | PR00452 | Src homology-3 | |
HMMPfam | IPR001478 | 57 | 135 | PF00595 | PDZ/DHR/GLGF |
IPR001452 | 175 | 234 | PF00018 | Src homology-3 | |
IPR008144 | 363 | 465 | PF00625 | Guanylate kinase | |
HMMSmart | IPR001478 | 65 | 138 | SM00228 | PDZ/DHR/GLGF |
IPR001452 | 175 | 241 | SM00326 | Src homology-3 | |
IPR008145 | 329 | 508 | SM00072 | Guanylate kinase/L-type calcium channel region | |
ProfileScan | IPR001478 | 57 | 138 | PS50106 | PDZ/DHR/GLGF |
IPR001452 | 172 | 242 | PS50002 | Src homology-3 | |
IPR008144 | 330 | 505 | PS50052 | Guanylate kinase | |
ScanRegExp | IPR008144 | 362 | 379 | PS00856 | Guanylate kinase |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAGAACATTCAGCCCCAGCAC |
Primer_r | GCAGTGTTAAGGGTGTGTCTC |
PCR product length | 76 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |