Order Kazusa clone(s) from : ![]() |
Product ID | ORK01982 |
---|---|
Accession No | AB011172 |
Description | histone deacetylase 5 |
Clone name | fh08981 |
Vector information | |
cDNA sequence | DNA sequence (5040 bp) Predicted protein sequence (1080 aa) |
HaloTag ORF Clone |
FHC01982
![]() |
Flexi ORF Clone | FXC01982 |
Source | Human fetal brain |
Rouge ID |
mKIAA0600
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00785a, former representative clones for KIAA0600 with fh08981. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1622 bp |
---|---|
Genome contig ID | gi51511734r_39409648 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 39509648 | 39556512 | 25 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000286 | 787 | 810 | PR01270 | Histone deacetylase superfamily |
IPR000286 | 821 | 836 | PR01270 | Histone deacetylase superfamily | |
IPR000286 | 912 | 922 | PR01270 | Histone deacetylase superfamily | |
HMMPfam | IPR000286 | 642 | 986 | PF00850 | Histone deacetylase superfamily |
![]() |
---|
![]() |
Primer_f | TCTCGGCTCTGCTCAGTGTAG |
---|---|
Primer_r | TTTGCTCTGGATCTCGATGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGCACTCTGAATACCACACCC |
Primer_r | CCACAAGGCAGCACAGCATAC |
PCR product length | 118 (1.0k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |