KIAA0600

Product ID	ORK01982
Accession No	AB011172
Description	histone deacetylase 5
Clone name	fh08981
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5040 bp) Predicted protein sequence (1080 aa)
HaloTag ORF Clone	FHC01982
Flexi ORF Clone	FXC01982
Source	Human fetal brain
Rouge ID	mKIAA0600 by Kazusa Mouse cDNA Project
Note	We replaced hg00785a, former representative clones for KIAA0600 with fh08981. (2002/5/10)

Length: 5040 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1622 bp
Genome contig ID	gi51511734r_39409648
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTCCTTGTGTAAATAAACTTGTTTCTGGCAGTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTCTGGGGCCAATGTCTCTATTCTCTGGGCTCCCAAATGGAGTAGAGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	39509648	39556512	25	99.7	Perfect prediction

Length: 1080 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG72583	0	100.0	histone deacety...	synthetic construct
CAM25071	0	94.7	histone deacety...	Mus musculus
BAG57895	8.6e-198	90.2	unnamed protein...	Homo sapiens
NP_005465	1e-197	92.4	histone deacety...	Homo sapiens
EAW51633	1.6e-197	90.1	histone deacety...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006626	9.9e-44	52.9	KIAA0288
AB018287	3e-31	50.5	KIAA0744
AB020708	2.3e-15	46.9	KIAA0901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000286	787	810	PR01270	Histone deacetylase superfamily
	IPR000286	821	836	PR01270	Histone deacetylase superfamily
	IPR000286	912	922	PR01270	Histone deacetylase superfamily
HMMPfam	IPR000286	642	986	PF00850	Histone deacetylase superfamily

Primer_f	TCTCGGCTCTGCTCAGTGTAG
Primer_r	TTTGCTCTGGATCTCGATGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGCACTCTGAATACCACACCC
Primer_r	CCACAAGGCAGCACAGCATAC
PCR product length	118 (1.0k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles