KIAA1311

Product ID	ORK06606
Accession No	AB037732
Description	RNA binding motif protein 27
Clone name	fh11512
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh11512 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5774 bp) Predicted protein sequence (889 aa)
Source	Human fetal brain
Rouge ID	mKIAA1311 by Kazusa Mouse cDNA Project

Length: 5774 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3102 bp
Genome contig ID	gi51511721f_145489589
PolyA signal sequence (AATAAA,-34)	+--------+--------+----*----+---- CAATAAAGATGCAATATGGAATGGTTCACAATTGG
Flanking genome sequence (159301 - 159350)	----+--------+--------+--------+--------+----* AAAAAAAAAAGAAAAAAGATGAAAGTATTACAAATTTAAAAGAATTTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	145589589	145648888	17	100.0	Perfect prediction

Length: 889 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2N5	100.0	RNA-binding pro...	Homo sapiens
XP_527062	99.9	RNA binding mot...	Pan troglodytes
XP_001100227	99.5	similar to cuta...	Macaca mulatta
XP_544327	97.1	similar to cuta...	Canis lupus fam...
XP_001503958	97.1	RNA binding mot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	103	129	PF00642	Zinc finger
HMMPfam	IPR000504	445	498	PF00076	RNA recognition motif
HMMSmart	IPR000504	430	499	SM00360	RNA recognition motif
ProfileScan	IPR000504	429	503	PS50102	RNA recognition motif

Primer_f	CTTGCTCCTTACTCCTCCATC
Primer_r	TCCTTTGTTCCCTCTATCACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-