Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00844 |
---|---|
Accession No | AB040898 |
Description | immunoglobulin superfamily containing leucine-rich repeat 2, transcript variant 2 |
Clone name | fh13187 |
Vector information | |
cDNA sequence | DNA sequence (4815 bp) Predicted protein sequence (785 aa) |
HaloTag ORF Clone |
FHC00844
|
Flexi ORF Clone | FXC00844 |
Source | Human fetal brain |
Rouge ID |
mKIAA1465
by Kazusa Mouse cDNA Project
|
Note | We replaced fj00601, former representative clones for KIAA1465 with fh13187. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1808 bp |
---|---|
Genome contig ID | gi51511731f_72108768 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (107428 - 107477) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 72208768 | 72216194 | 4 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 141 | 154 | PR00019 | Leucine-rich repeat |
IPR001611 | 162 | 175 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 92 | 114 | PF00560 | Leucine-rich repeat |
IPR001611 | 116 | 138 | PF00560 | Leucine-rich repeat | |
IPR001611 | 140 | 162 | PF00560 | Leucine-rich repeat | |
IPR001611 | 164 | 186 | PF00560 | Leucine-rich repeat | |
IPR001611 | 188 | 210 | PF00560 | Leucine-rich repeat | |
IPR000483 | 248 | 271 | PF01463 | Cysteine-rich flanking region | |
IPR013098 | 281 | 412 | PF07679 | Immunoglobulin I-set | |
HMMSmart | IPR003591 | 89 | 113 | SM00369 | Leucine-rich repeat |
IPR003591 | 114 | 137 | SM00369 | Leucine-rich repeat | |
IPR003591 | 138 | 161 | SM00369 | Leucine-rich repeat | |
IPR003591 | 162 | 185 | SM00369 | Leucine-rich repeat | |
IPR003591 | 186 | 209 | SM00369 | Leucine-rich repeat | |
IPR000483 | 221 | 271 | SM00082 | Cysteine-rich flanking region | |
ProfileScan | IPR007110 | 273 | 411 | PS50835 | Immunoglobulin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | GHNTCVYLAWAIFPALP | 17 | SECONDARY | 17 | 2 | 36 | ILGAAMFPLRALWLVWALLGVAG | 58 | PRIMARY | 23 | 3 | 633 | IVAVSVFLLVLATVPLLGAACCH | 655 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TGTTACACTGCATCGCCGACG |
---|---|
Primer_r | GCGTCAGCAAATCCCCATCTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | TGTTACACTGCATCGCCGACG |
Primer_r | GCGTCAGCAAATCCCCATCTC |
PCR product length | 162 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |