KIAA1319

Product ID	ORK01159
Accession No	AB037740
Description	cingulin
Clone name	fh13717
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5073 bp) Predicted protein sequence (1208 aa)
HaloTag ORF Clone	FHC01159
Flexi ORF Clone	FXC01159
Source	Human fetal brain
Rouge ID	mKIAA1319 by Kazusa Mouse cDNA Project

Length: 5073 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1344 bp
Genome contig ID	gi89161185f_149657605
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TTTAAATTAAATATTAAAATTACACATTTATATTG
Flanking genome sequence (120186 - 120235)	----+--------+--------+--------+--------+----* AAATCCTTGGTTTGTCTTCTCATTCTTTTTCTTGGCATATTTGGAGGTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	149750519	149777789	21	99.6	Perfect prediction

Length: 1208 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAF74498	100.0	cingulin [Homo ...	Homo sapiens
Q9P2M7	100.0	Cingulin.	Homo sapiens
XP_513800	99.1	cingulin [Pan t...	Pan troglodytes
XP_001108356	97.3	similar to cing...	Macaca mulatta
ABY40800	97.5	cingulin (predi...	Papio anubis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051536	5.8e-34	33.2	KIAA1749
AB020673	3.7e-15	27.6	KIAA0866
AB111886	5.3e-14	26.0	KIAA2034
AB040945	5.2e-09	24.2	KIAA1512
AB028975	1.2e-05	24.6	KIAA1052

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002928	972	1142	PF01576	Myosin tail

Primer_f	TCCCAGAATCAGTTGTTGCAG
Primer_r	GTCCAGTCGCTCAATTTCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-