KIAA1338

Product ID	ORK04865
Accession No	AB037759
Description	eukaryotic translation initiation factor 2 alpha kinase 4
Clone name	fh16948
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh16948 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCA CGCGTCCGCG GACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4994 bp) Predicted protein sequence (1495 aa)
Source	Human fetal brain
Rouge ID	mKIAA1338 by Kazusa Mouse cDNA Project

Length: 4994 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	506 bp
Genome contig ID	gi51511731f_37935111
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATTTATCTTTTGGGATATAATAAATGCTTTCATAT
Flanking genome sequence (179974 - 180023)	----+--------+--------+--------+--------+----* ACCTGCTGCTTTTTAATTGTAAATCTATTAACACTAAAGGTTTTAGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	38033407	38115083	35	99.8	Terminal No-hit

Length: 1495 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2K8	100.0	Eukaryotic tran...	Homo sapiens
XP_001140245	99.9	eukaryotic tran...	Pan troglodytes
AAI46320	99.9	Eukaryotic tran...	synthetic construct
XP_001501317	94.0	similar to Euka...	Equus caballus
XP_001139259	97.4	eukaryotic tran...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037790	1.2e-05	33.9	KIAA1369

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	196	295	PD000001	Protein kinase
	IPR000719	436	506	PD000001	Protein kinase
	IPR000719	642	838	PD000001	Protein kinase
HMMPfam	IPR000719	178	289	PF00069	Protein kinase
	IPR000719	436	847	PF00069	Protein kinase
	IPR002314	909	1069	PF00587	Aminoacyl-tRNA synthetase
HMMSmart	IPR002290	132	385	SM00220	Serine/threonine protein kinase
	IPR001245	436	847	SM00219	Tyrosine protein kinase
	IPR002290	436	847	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	142	385	PS50011	Protein kinase
ProfileScan	IPR000719	436	847	PS50011	Protein kinase
ScanRegExp	IPR000719	442	465	PS00107	Protein kinase
	IPR006172	533	541	PS00116	DNA-directed DNA polymerase B
	IPR008271	690	702	PS00108	Serine/threonine protein kinase

Primer_f	TGAAAGGAATGGCAGAGAAGC
Primer_r	GTCTGAAGTCGAGTTTGTACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-