KIAA1459

Product ID	ORK04903
Accession No	AB040892
Description	EPH receptor A8
Clone name	fh16961
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4417 bp) Predicted protein sequence (853 aa)
Source	Human fetal brain
Rouge ID	mKIAA1459 by Kazusa Mouse cDNA Project

Length: 4417 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1853 bp
Genome contig ID	gi89161185f_22675592
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTACCCACAATAAGAATAAATTCTGCCTCATCTTT
Flanking genome sequence (127084 - 127133)	----+--------+--------+--------+--------+----* GCCTGCGTCCCCCATTTTTTCCCCATCTCTGAAAGCTTGACATCTCCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	22775592	22802674	15	99.4	Perfect prediction

Length: 853 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P29322	99.8	Ephrin type-A r...	Homo sapiens
XP_001101560	98.9	similar to EPH ...	Macaca mulatta
XP_595537	96.8	similar to EPH ...	Bos taurus
XP_001501554	96.7	EPH receptor A8...	Equus caballus
EDL29925	95.1	Eph receptor A8...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023216	3.8e-10	28.7	KIAA0999
AB032968	4e-10	26.0	KIAA1142
AB033104	6.3e-10	26.4	KIAA1278
AB018324	7.2e-10	28.7	KIAA0781
AB033090	4.6e-09	29.1	KIAA1264

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001090	1	53	PD001495	Ephrin receptor
BlastProDom	IPR000719	490	747	PD000001	Protein kinase
FPrintScan	IPR003962	190	199	PR00014	Fibronectin
	IPR003962	315	325	PR00014	Fibronectin
	IPR003962	338	356	PR00014	Fibronectin
	IPR003962	356	370	PR00014	Fibronectin
	IPR001245	561	574	PR00109	Tyrosine protein kinase
	IPR001245	598	616	PR00109	Tyrosine protein kinase
	IPR001245	648	658	PR00109	Tyrosine protein kinase
	IPR001245	667	689	PR00109	Tyrosine protein kinase
	IPR001245	711	733	PR00109	Tyrosine protein kinase
HMMPfam	IPR001090	1	52	PF01404	Ephrin receptor
	IPR003961	177	273	PF00041	Fibronectin
	IPR003961	285	372	PF00041	Fibronectin
	IPR001245	483	740	PF07714	Tyrosine protein kinase
	IPR001660	779	840	PF00536	Sterile alpha motif SAM
HMMSmart	IPR003961	177	267	SM00060	Fibronectin
	IPR003961	288	369	SM00060	Fibronectin
	IPR001245	483	740	SM00219	Tyrosine protein kinase
	IPR002290	483	744	SM00220	Serine/threonine protein kinase
	IPR001660	775	842	SM00454	Sterile alpha motif SAM
ProfileScan	IPR003961	176	278	PS50853	Fibronectin
	IPR003961	284	379	PS50853	Fibronectin
	IPR000719	483	744	PS50011	Protein kinase
	IPR001660	782	842	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR001426	33	53	PS00790	Receptor tyrosine kinase
	IPR001426	95	115	PS00791	Receptor tyrosine kinase
	IPR013032	108	121	PS01186	EGF-like region
	IPR000719	489	515	PS00107	Protein kinase
	IPR008266	604	616	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	28	GFYLAFQDIGACLAILSLRIYY	49	SECONDARY	22
SOSUI2	2	390	TIVWICLTLITGLVVLLLLLIC	411	PRIMARY	22

Primer_f	CAGGCACCTTCTCTTTTCCAG
Primer_r	GAGATCCCATGACCTTGTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-