KIAA1460

Gene/Protein Characteristic Table for KIAA1460

Order Kazusa clone(s) from :

Product ID	ORK07178
Accession No	AB040893
Description	trinucleotide repeat containing 6A
Clone name	fh17570
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5273 bp) Predicted protein sequence (1400 aa)
Source	Human fetal brain
Rouge ID	mKIAA1460 by Kazusa Mouse cDNA Project

Length: 5273 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1070 bp
Genome contig ID	gi51511732f_24609156
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTACATATTGCTCTGTTAAAGAATTTTCTCTGCC
Flanking genome sequence (134543 - 134592)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAACAAAAAAACGCTTAAAGCTGGAGTTTGACATTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	24709151	24743697	20	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 1400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK62026	99.9	GW182 autoantig...	Homo sapiens
EAW55784	99.9	trinucleotide r...	Homo sapiens
Q8NDV7	99.9	Trinucleotide r...	Homo sapiens
NP_055309	99.9	trinucleotide r...	Homo sapiens
XP_001098013	99.2	similar to trin...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046802	1.4e-64	45.4	KIAA1582
AB029016	1.4e-59	39.1	KIAA1093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGAGCTTTTCCCTTTGCACTG
Primer_r	ATCCTAAGTCAGCATCCTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGAGCTTTTCCCTTTGCACTG
Primer_r	ATCCTAAGTCAGCATCCTAAC
PCR product length	192 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp