KIAA1787

Product ID	ORK00919
Accession No	AB058690
Description	neuralized E3 ubiquitin protein ligase 4, transcript variant 1
Clone name	fh19054
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5185 bp) Predicted protein sequence (1564 aa)
HaloTag ORF Clone	FHC00919
Flexi ORF Clone	FXC00919
Source	Human fetal brain
Rouge ID	mKIAA1787 by Kazusa Mouse cDNA Project

Length: 5185 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	489 bp
Genome contig ID	gi51511734r_7059677
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TCTGATTTCTAAGGAGCCAATAAACACCGTCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCTCCGCCTCGGCCTCTCTCTCGCGCGCCCCTCTCCGGAGCCCGCGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	7159677	7173362	29	100.0	Perfect prediction

Length: 1564 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW90217	99.9	hCG42028, isofo...	Homo sapiens
NP_001005408	99.9	neuralized homo...	Homo sapiens
EAW90213	99.8	hCG42028, isofo...	Homo sapiens
XP_606908	96.6	similar to G pr...	Bos taurus
CAB66804	99.7	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006573	46	113	PF07177	NEUZ
	IPR006573	319	389	PF07177	NEUZ
	IPR006573	522	592	PF07177	NEUZ
	IPR006573	718	788	PF07177	NEUZ
	IPR006573	917	982	PF07177	NEUZ
	IPR006573	1133	1200	PF07177	NEUZ
HMMSmart	IPR006573	47	165	SM00588	NEUZ
	IPR006573	317	442	SM00588	NEUZ
	IPR006573	520	644	SM00588	NEUZ
	IPR006573	716	840	SM00588	NEUZ
	IPR006573	913	1044	SM00588	NEUZ
	IPR006573	1131	1251	SM00588	NEUZ
ProfileScan	IPR006573	43	209	PS51065	NEUZ
	IPR006573	319	486	PS51065	NEUZ
	IPR006573	522	688	PS51065	NEUZ
	IPR006573	718	886	PS51065	NEUZ
	IPR006573	915	1088	PS51065	NEUZ
	IPR006573	1133	1296	PS51065	NEUZ

Primer_f	AAGATTATTTCATGCCTCCGC
Primer_r	TATGCCATGTGCCACTTCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-