KIAA1629

Product ID	ORK07492
Accession No	AB046849
Description	zinc finger protein 532
Clone name	fh20517
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5595 bp) Predicted protein sequence (1329 aa)
Source	Human fetal brain
Rouge ID	mKIAA1629 by Kazusa Mouse cDNA Project
Note	We replaced fh14869, former representative clones for KIAA1629 with fh20517. (2001/2/22)

Length: 5595 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1477 bp
Genome contig ID	gi51511735f_54583680
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ACACATTTCATATGTAAATAAACGTGGGACATTTG
Flanking genome sequence (220478 - 220527)	----+--------+--------+--------+--------+----* GCCCTTGTGCTTCTGTGAGAGAATTATTGATGGTGGGTCTCTGACATCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	54681688	54804156	11	99.6	Perfect prediction

Length: 1329 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001089453	98.9	similar to zinc...	Macaca mulatta
Q9HCE3	100.0	Zinc finger pro...	Homo sapiens
BAG54624	99.9	unnamed protein...	Homo sapiens
EDM14687	91.8	zinc finger pro...	Rattus norvegicus
EDL09689	90.3	zinc finger pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037862	7.5e-44	36.4	KIAA1441
D86966	7.2e-40	40.2	KIAA0211
AB058730	0.00017	24.9	KIAA1827
AB075862	0.00019	23.7	KIAA1982
AB002324	0.00019	22.9	KIAA0326

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	870	893	PF00096	Zinc finger
	IPR007087	898	921	PF00096	Zinc finger
	IPR007087	933	955	PF00096	Zinc finger
	IPR007087	964	987	PF00096	Zinc finger
	IPR007087	1083	1106	PF00096	Zinc finger
	IPR007087	1231	1254	PF00096	Zinc finger
	IPR007087	1292	1314	PF00096	Zinc finger
HMMSmart	IPR015880	644	664	SM00355	Zinc finger
	IPR015880	672	696	SM00355	Zinc finger
	IPR015880	782	802	SM00355	Zinc finger
	IPR015880	811	833	SM00355	Zinc finger
	IPR015880	839	863	SM00355	Zinc finger
	IPR015880	870	893	SM00355	Zinc finger
	IPR015880	898	921	SM00355	Zinc finger
	IPR015880	933	955	SM00355	Zinc finger
	IPR015880	964	987	SM00355	Zinc finger
	IPR015880	1053	1076	SM00355	Zinc finger
	IPR015880	1083	1106	SM00355	Zinc finger
	IPR015880	1113	1139	SM00355	Zinc finger
	IPR015880	1202	1224	SM00355	Zinc finger
	IPR015880	1231	1254	SM00355	Zinc finger
	IPR015880	1292	1314	SM00355	Zinc finger
ProfileScan	IPR007087	644	662	PS50157	Zinc finger
	IPR007087	782	812	PS50157	Zinc finger
	IPR007087	898	926	PS50157	Zinc finger
	IPR007087	933	960	PS50157	Zinc finger
	IPR007087	964	992	PS50157	Zinc finger
	IPR007087	1083	1111	PS50157	Zinc finger
	IPR007087	1231	1259	PS50157	Zinc finger
	IPR007087	1292	1314	PS50157	Zinc finger
ScanRegExp	IPR007087	813	835	PS00028	Zinc finger
	IPR007087	872	893	PS00028	Zinc finger
	IPR007087	900	921	PS00028	Zinc finger
	IPR007087	935	955	PS00028	Zinc finger
	IPR007087	966	987	PS00028	Zinc finger
	IPR007087	1055	1076	PS00028	Zinc finger
	IPR007087	1085	1106	PS00028	Zinc finger
	IPR007087	1233	1254	PS00028	Zinc finger
	IPR007087	1294	1314	PS00028	Zinc finger

Primer_f	TCCCTTCCGTTTATAGTTCTC
Primer_r	GGAACCGAACATTGACTACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CTGAAGAGTTTGATGACGACG
Primer_r	CACATTGCCTGACGTAGAGAG
PCR product length	182 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles