Order Kazusa clone(s) from : ![]() |
Product ID | ORK07441 |
---|---|
Accession No | AB075827 |
Description | zinc finger protein 17 |
Clone name | fh23660 |
Vector information | |
cDNA sequence | DNA sequence (5700 bp) Predicted protein sequence (608 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3873 bp |
---|---|
Genome contig ID | gi42406306f_62522835 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence | None |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 62622835 | 62631608 | 2 | 99.0 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 136 | 159 | PD000003 | Zinc finger |
IPR007087 | 164 | 187 | PD000003 | Zinc finger | |
IPR007087 | 192 | 215 | PD000003 | Zinc finger | |
IPR007087 | 220 | 243 | PD000003 | Zinc finger | |
IPR007087 | 248 | 271 | PD000003 | Zinc finger | |
IPR007087 | 276 | 299 | PD000003 | Zinc finger | |
IPR007087 | 304 | 327 | PD000003 | Zinc finger | |
IPR007087 | 332 | 355 | PD000003 | Zinc finger | |
IPR007087 | 360 | 383 | PD000003 | Zinc finger | |
IPR007087 | 388 | 411 | PD000003 | Zinc finger | |
IPR007087 | 416 | 439 | PD000003 | Zinc finger | |
IPR007087 | 444 | 467 | PD000003 | Zinc finger | |
IPR007087 | 500 | 523 | PD000003 | Zinc finger | |
IPR007087 | 528 | 551 | PD000003 | Zinc finger | |
IPR007087 | 556 | 579 | PD000003 | Zinc finger | |
IPR007087 | 584 | 607 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 136 | 158 | PF00096 | Zinc finger |
IPR007087 | 164 | 186 | PF00096 | Zinc finger | |
IPR007087 | 192 | 214 | PF00096 | Zinc finger | |
IPR007087 | 220 | 242 | PF00096 | Zinc finger | |
IPR007087 | 248 | 270 | PF00096 | Zinc finger | |
IPR007087 | 276 | 298 | PF00096 | Zinc finger | |
IPR007087 | 304 | 326 | PF00096 | Zinc finger | |
IPR007087 | 332 | 354 | PF00096 | Zinc finger | |
IPR007087 | 360 | 382 | PF00096 | Zinc finger | |
IPR007087 | 388 | 410 | PF00096 | Zinc finger | |
IPR007087 | 416 | 438 | PF00096 | Zinc finger | |
IPR007087 | 444 | 466 | PF00096 | Zinc finger | |
IPR007087 | 472 | 494 | PF00096 | Zinc finger | |
IPR007087 | 500 | 522 | PF00096 | Zinc finger | |
IPR007087 | 528 | 550 | PF00096 | Zinc finger | |
IPR007087 | 556 | 578 | PF00096 | Zinc finger | |
IPR007087 | 584 | 606 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 30 | 52 | SM00355 | Zinc finger |
IPR015880 | 136 | 158 | SM00355 | Zinc finger | |
IPR015880 | 164 | 186 | SM00355 | Zinc finger | |
IPR015880 | 192 | 214 | SM00355 | Zinc finger | |
IPR015880 | 220 | 242 | SM00355 | Zinc finger | |
IPR015880 | 248 | 270 | SM00355 | Zinc finger | |
IPR015880 | 276 | 298 | SM00355 | Zinc finger | |
IPR015880 | 304 | 326 | SM00355 | Zinc finger | |
IPR015880 | 332 | 354 | SM00355 | Zinc finger | |
IPR015880 | 360 | 382 | SM00355 | Zinc finger | |
IPR015880 | 388 | 410 | SM00355 | Zinc finger | |
IPR015880 | 416 | 438 | SM00355 | Zinc finger | |
IPR015880 | 444 | 466 | SM00355 | Zinc finger | |
IPR015880 | 472 | 494 | SM00355 | Zinc finger | |
IPR015880 | 500 | 522 | SM00355 | Zinc finger | |
IPR015880 | 528 | 550 | SM00355 | Zinc finger | |
IPR015880 | 556 | 578 | SM00355 | Zinc finger | |
IPR015880 | 584 | 606 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 136 | 163 | PS50157 | Zinc finger |
IPR007087 | 164 | 191 | PS50157 | Zinc finger | |
IPR007087 | 192 | 219 | PS50157 | Zinc finger | |
IPR007087 | 220 | 247 | PS50157 | Zinc finger | |
IPR007087 | 248 | 275 | PS50157 | Zinc finger | |
IPR007087 | 276 | 303 | PS50157 | Zinc finger | |
IPR007087 | 304 | 331 | PS50157 | Zinc finger | |
IPR007087 | 332 | 359 | PS50157 | Zinc finger | |
IPR007087 | 360 | 387 | PS50157 | Zinc finger | |
IPR007087 | 388 | 415 | PS50157 | Zinc finger | |
IPR007087 | 416 | 443 | PS50157 | Zinc finger | |
IPR007087 | 444 | 471 | PS50157 | Zinc finger | |
IPR007087 | 472 | 499 | PS50157 | Zinc finger | |
IPR007087 | 500 | 527 | PS50157 | Zinc finger | |
IPR007087 | 528 | 555 | PS50157 | Zinc finger | |
IPR007087 | 556 | 583 | PS50157 | Zinc finger | |
IPR007087 | 584 | 608 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 32 | 52 | PS00028 | Zinc finger |
IPR007087 | 138 | 158 | PS00028 | Zinc finger | |
IPR007087 | 166 | 186 | PS00028 | Zinc finger | |
IPR007087 | 194 | 214 | PS00028 | Zinc finger | |
IPR007087 | 222 | 242 | PS00028 | Zinc finger | |
IPR007087 | 250 | 270 | PS00028 | Zinc finger | |
IPR007087 | 278 | 298 | PS00028 | Zinc finger | |
IPR007087 | 306 | 326 | PS00028 | Zinc finger | |
IPR007087 | 334 | 354 | PS00028 | Zinc finger | |
IPR007087 | 362 | 382 | PS00028 | Zinc finger | |
IPR007087 | 390 | 410 | PS00028 | Zinc finger | |
IPR007087 | 418 | 438 | PS00028 | Zinc finger | |
IPR007087 | 446 | 466 | PS00028 | Zinc finger | |
IPR007087 | 474 | 494 | PS00028 | Zinc finger | |
IPR007087 | 502 | 522 | PS00028 | Zinc finger | |
IPR007087 | 530 | 550 | PS00028 | Zinc finger | |
IPR007087 | 558 | 578 | PS00028 | Zinc finger | |
IPR007087 | 586 | 606 | PS00028 | Zinc finger |
![]() |
Primer_f | AGTCCGGGTACCTCATATAAG |
---|---|
Primer_r | ATAACACTTTTCTCAGGACAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |