Order Kazusa clone(s) from : ![]() |
Product ID | ORK06593 |
---|---|
Accession No | AB051468 |
Description | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 |
Clone name | fh23697 |
Vector information | |
cDNA sequence | DNA sequence (5135 bp) Predicted protein sequence (1236 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1424 bp |
---|---|
Genome contig ID | gi89161199r_203911003 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (257277 - 257228) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 204010992 | 204068279 | 13 | 99.3 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001904 | 694 | 717 | PR00832 | Paxillin |
IPR001904 | 805 | 828 | PR00832 | Paxillin | |
IPR001904 | 860 | 879 | PR00832 | Paxillin | |
HMMPfam | IPR000159 | 255 | 342 | PF00788 | Ras-association |
IPR001849 | 383 | 491 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR000159 | 255 | 341 | SM00314 | Ras-association |
IPR001849 | 383 | 493 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000159 | 255 | 341 | PS50200 | Ras-association |
IPR001849 | 382 | 491 | PS50003 | Pleckstrin-like |
![]() |
Primer_f | TTCATTTATAGCTACTGGGGC |
---|---|
Primer_r | GCACTGACTCCACGTTATACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | TTCATTTATAGCTACTGGGGC |
Primer_r | GCACTGACTCCACGTTATACC |
PCR product length | 160 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |