Order Kazusa clone(s) from : ![]() |
Product ID | ORK05702 |
---|---|
Accession No | AB051470 |
Description | Uncharacterized protein KIAA1683. |
Clone name | fh24307 |
Vector information | |
cDNA sequence | DNA sequence (5483 bp) Predicted protein sequence (832 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2984 bp |
---|---|
Genome contig ID | gi42406306r_18128909 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 18228909 | 18234428 | 6 | 97.8 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR008165 | 361 | 445 | PD003992 | Protein of unknown function GLTT |
ScanRegExp | IPR000005 | 638 | 682 | PS00041 | Helix-turn-helix |
![]() |
Primer_f | AGCAAATGGCAGCGAAGATAG |
---|---|
Primer_r | TTAGACCCAGAGAGCCATGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |