KIAA1346

Product ID	ORK00218
Accession No	AB037767
Description	ADAM metallopeptidase with thrombospondin type 1 motif, 1
Clone name	fj00671
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4309 bp) Predicted protein sequence (999 aa)
HaloTag ORF Clone	FHC00218
Flexi ORF Clone	FXC00218
Source	Human fetal brain
Rouge ID	mKIAA1346 by Kazusa Mouse cDNA Project

Length: 4309 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1290 bp
Genome contig ID	gi51511750r_27030479
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATATATGTTACTAGAAATAAAAGAACACTTTTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGTGTGTCTGTTTTTTGAAGTGGGAATTCATTCCTAGGAAGGAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	r	27130479	27139259	9	99.8	Perfect prediction

Length: 999 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11309	100.0	ADAM metallopep...	synthetic construct
CAI46043	99.9	hypothetical pr...	Homo sapiens
AAF15317	99.8	metalloproteina...	Homo sapiens
AAH36515	99.9	ADAM metallopep...	Homo sapiens
Q9UHI8	99.9	A disintegrin a...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014588	2.1e-129	49.8	KIAA0688
AB037733	2.9e-109	39.9	KIAA1312
AB002364	3.1e-67	31.5	KIAA0366
AB095949	6.1e-47	34.9	KIAA2029
AB011177	6.8e-22	29.9	KIAA0605

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013274	33	51	PR01858	Peptidase M12B
	IPR013274	134	145	PR01858	Peptidase M12B
	IPR013274	196	208	PR01858	Peptidase M12B
	IPR013274	226	240	PR01858	Peptidase M12B
	IPR013274	345	356	PR01858	Peptidase M12B
	IPR013273	600	618	PR01857	Peptidase M12B
	IPR013274	646	655	PR01858	Peptidase M12B
	IPR013273	717	736	PR01857	Peptidase M12B
	IPR013273	737	756	PR01857	Peptidase M12B
	IPR013274	959	975	PR01858	Peptidase M12B
HMMPfam	IPR002870	66	205	PF01562	Peptidase M12B
	IPR001590	290	499	PF01421	Peptidase M12B
	IPR000884	595	645	PF00090	Thrombospondin
	IPR010294	757	875	PF05986	ADAM-TS Spacer 1
	IPR000884	888	941	PF00090	Thrombospondin
	IPR000884	947	998	PF00090	Thrombospondin
HMMSmart	IPR006586	500	580	SM00608	ADAM
	IPR000884	594	646	SM00209	Thrombospondin
	IPR000884	889	942	SM00209	Thrombospondin
	IPR000884	943	999	SM00209	Thrombospondin
ProfileScan	IPR001590	290	499	PS50215	Peptidase M12B
	IPR000884	591	646	PS50092	Thrombospondin
	IPR000884	886	937	PS50092	Thrombospondin
	IPR000884	940	999	PS50092	Thrombospondin
ScanRegExp	IPR006025	430	439	PS00142	Peptidase M
ScanRegExp	IPR001128	524	533	PS00086	Cytochrome P450

Primer_f	CCCTGTTTCCTGGTACTTATC
Primer_r	CCATAGCAGCCATAAACAGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-