Order Kazusa clone(s) from : ![]() |
Product ID | ORK00810 |
---|---|
Accession No | AB037769 |
Description | pyruvate dehyrogenase phosphatase catalytic subunit 2 |
Clone name | fj00937 |
Vector information | |
cDNA sequence | DNA sequence (3830 bp) Predicted protein sequence (545 aa) |
HaloTag ORF Clone |
FHC00810
![]() |
Flexi ORF Clone | FXC00810 |
Source | Human fetal brain |
Rouge ID |
mKIAA1348
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2078 bp |
---|---|
Genome contig ID | gi51511732f_65371937 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (107421 - 107470) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 65471937 | 65479356 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ACCACCATTGCTAGTCCTCAG |
---|---|
Primer_r | CAAAGAGTCTACAGCCCACAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCACCATTGCTAGTCCTCAG |
Primer_r | CAAAGAGTCTACAGCCCACAG |
PCR product length | 104 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |