Gene/Protein Characteristic Table for KIAA1349
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00811
Accession No AB037770
Description zinc finger protein 624
Clone name fj00940
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4055 bp)
Predicted protein sequence (752 aa)
Flexi ORF Clone FXC00811
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 4055 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1544 bp
Genome contig ID gi51511734r_16364776
PolyA signal sequence
(ATTAAA,-18)		 
+----*----+----*----+----*----+----
GAACCTGTAATATTTACATTAAAAGGAAAAATATT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
TTCGTTGTGCGTTTTATTTATTGGACACCTTCAATGTGCCAGGACCTACC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 r 16464776 16474544 2 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 752 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_065838 0 99.9 zinc finger pro...
 Homo sapiens
EAX04519 0 99.9 zinc finger pro...
 Homo sapiens
BAD18548 0 99.9 unnamed protein...
 Homo sapiens
Q9P2J8 0 100.0 Zinc finger pro...
 Homo sapiens
AAI03945 0 99.9 ZNF624 protein ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 1.5e-117 51.9 KIAA1611
AB075862 1.3e-107 53.4 KIAA1982
AB107355 2.6e-98 53.1 KIAA2033
D31763 2.1e-91 45.1 KIAA0065
AB058755 2.2e-88 45.2 KIAA1852
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 163 186 PD000003 Zinc finger
IPR007087 191 214 PD000003 Zinc finger
IPR007087 219 242 PD000003 Zinc finger
IPR007087 247 267 PD000003 Zinc finger
IPR007087 275 297 PD000003 Zinc finger
IPR007087 303 326 PD000003 Zinc finger
IPR007087 331 354 PD000003 Zinc finger
IPR007087 359 382 PD000003 Zinc finger
IPR007087 387 410 PD000003 Zinc finger
IPR007087 415 438 PD000003 Zinc finger
IPR007087 443 466 PD000003 Zinc finger
IPR007087 471 494 PD000003 Zinc finger
IPR007087 527 550 PD000003 Zinc finger
IPR007087 555 578 PD000003 Zinc finger
IPR007087 583 606 PD000003 Zinc finger
IPR007087 611 634 PD000003 Zinc finger
IPR007087 639 662 PD000003 Zinc finger
IPR007087 695 718 PD000003 Zinc finger
IPR007087 723 745 PD000003 Zinc finger
HMMPfam IPR007087 163 185 PF00096 Zinc finger
IPR007087 191 213 PF00096 Zinc finger
IPR007087 219 241 PF00096 Zinc finger
IPR007087 247 269 PF00096 Zinc finger
IPR007087 275 297 PF00096 Zinc finger
IPR007087 303 325 PF00096 Zinc finger
IPR007087 331 353 PF00096 Zinc finger
IPR007087 359 381 PF00096 Zinc finger
IPR007087 387 409 PF00096 Zinc finger
IPR007087 415 437 PF00096 Zinc finger
IPR007087 443 465 PF00096 Zinc finger
IPR007087 471 493 PF00096 Zinc finger
IPR007087 499 521 PF00096 Zinc finger
IPR007087 527 549 PF00096 Zinc finger
IPR007087 555 577 PF00096 Zinc finger
IPR007087 583 605 PF00096 Zinc finger
IPR007087 611 633 PF00096 Zinc finger
IPR007087 639 661 PF00096 Zinc finger
IPR007087 667 689 PF00096 Zinc finger
IPR007087 695 717 PF00096 Zinc finger
IPR007087 723 745 PF00096 Zinc finger
HMMSmart IPR015880 163 185 SM00355 Zinc finger
IPR015880 191 213 SM00355 Zinc finger
IPR015880 219 241 SM00355 Zinc finger
IPR015880 247 267 SM00355 Zinc finger
IPR015880 275 297 SM00355 Zinc finger
IPR015880 303 325 SM00355 Zinc finger
IPR015880 331 353 SM00355 Zinc finger
IPR015880 359 381 SM00355 Zinc finger
IPR015880 387 409 SM00355 Zinc finger
IPR015880 415 437 SM00355 Zinc finger
IPR015880 443 465 SM00355 Zinc finger
IPR015880 471 493 SM00355 Zinc finger
IPR015880 499 521 SM00355 Zinc finger
IPR015880 527 549 SM00355 Zinc finger
IPR015880 555 577 SM00355 Zinc finger
IPR015880 583 605 SM00355 Zinc finger
IPR015880 611 633 SM00355 Zinc finger
IPR015880 639 661 SM00355 Zinc finger
IPR015880 667 689 SM00355 Zinc finger
IPR015880 695 717 SM00355 Zinc finger
IPR015880 723 745 SM00355 Zinc finger
ProfileScan IPR007087 163 190 PS50157 Zinc finger
IPR007087 191 218 PS50157 Zinc finger
IPR007087 219 246 PS50157 Zinc finger
IPR007087 247 274 PS50157 Zinc finger
IPR007087 275 302 PS50157 Zinc finger
IPR007087 303 330 PS50157 Zinc finger
IPR007087 331 358 PS50157 Zinc finger
IPR007087 359 386 PS50157 Zinc finger
IPR007087 387 414 PS50157 Zinc finger
IPR007087 415 442 PS50157 Zinc finger
IPR007087 443 470 PS50157 Zinc finger
IPR007087 471 498 PS50157 Zinc finger
IPR007087 499 526 PS50157 Zinc finger
IPR007087 527 554 PS50157 Zinc finger
IPR007087 555 582 PS50157 Zinc finger
IPR007087 583 610 PS50157 Zinc finger
IPR007087 611 638 PS50157 Zinc finger
IPR007087 639 666 PS50157 Zinc finger
IPR007087 667 694 PS50157 Zinc finger
IPR007087 695 722 PS50157 Zinc finger
IPR007087 723 750 PS50157 Zinc finger
ScanRegExp IPR007087 165 185 PS00028 Zinc finger
IPR007087 193 213 PS00028 Zinc finger
IPR007087 221 241 PS00028 Zinc finger
IPR007087 277 297 PS00028 Zinc finger
IPR007087 305 325 PS00028 Zinc finger
IPR007087 333 353 PS00028 Zinc finger
IPR007087 361 381 PS00028 Zinc finger
IPR007087 389 409 PS00028 Zinc finger
IPR007087 417 437 PS00028 Zinc finger
IPR007087 445 465 PS00028 Zinc finger
IPR007087 473 493 PS00028 Zinc finger
IPR007087 501 521 PS00028 Zinc finger
IPR007087 529 549 PS00028 Zinc finger
IPR007087 557 577 PS00028 Zinc finger
IPR007087 585 605 PS00028 Zinc finger
IPR007087 613 633 PS00028 Zinc finger
IPR007087 641 661 PS00028 Zinc finger
IPR007087 669 689 PS00028 Zinc finger
IPR007087 697 717 PS00028 Zinc finger
IPR007087 725 745 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCCTCCCTTAACCCTACCTTC
Primer_r CCTAAGCTGGGGCAATCTCAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f GCCTCCCTTAACCCTACCTTC
Primer_r CCTAAGCTGGGGCAATCTCAC
PCR product length 128 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp