Gene/Protein Characteristic Table for KIAA1380
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05560
Accession No AB037801
Description jumonji domain containing 1C
Clone name fj05118
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4614 bp)
Predicted protein sequence (1265 aa)
Source Human fetal brain
Rouge ID mKIAA1380 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4614 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 815 bp
Genome contig ID gi89161187r_64496996
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
AGGGGTTTTACATTTTCCATTAAAAGGACTTTATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATTGACTTTTTCCAGAGTACTCCCTCTGTTGACAAGCATGACACTG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 10 r 64596996 64637613 17 99.6 Perfect prediction
Features of the protein sequence
Description

Length: 1265 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI10948 0 99.9 jumonji domain ...
Homo sapiens
XP_001166627 0 99.9 jumonji domain ...
Pan troglodytes
XP_001166664 0 99.9 jumonji domain ...
Pan troglodytes
XP_001166726 0 99.9 jumonji domain ...
Pan troglodytes
ABK64187 0 99.9 jumonji domain-...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029005 2.2e-73 40.1 KIAA1082
AB018285 2e-61 41.8 KIAA0742
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013129 1107 1206 PF02373 Transcription factor jumonji
HMMSmart IPR003347 999 1223 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan IPR003347 999 1223 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGAAATACCTGGTGCTCTGTG
Primer_r ACTCCATATTCTTCAAGCAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 10
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp