KIAA1380

Product ID	ORK05560
Accession No	AB037801
Description	jumonji domain containing 1C
Clone name	fj05118
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4614 bp) Predicted protein sequence (1265 aa)
Source	Human fetal brain
Rouge ID	mKIAA1380 by Kazusa Mouse cDNA Project

Length: 4614 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	815 bp
Genome contig ID	gi89161187r_64496996
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- AGGGGTTTTACATTTTCCATTAAAAGGACTTTATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATTGACTTTTTCCAGAGTACTCCCTCTGTTGACAAGCATGACACTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	64596996	64637613	17	99.6	Perfect prediction

Length: 1265 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI10948	99.9	jumonji domain ...	Homo sapiens
XP_001166627	99.9	jumonji domain ...	Pan troglodytes
XP_001166664	99.9	jumonji domain ...	Pan troglodytes
XP_001166726	99.9	jumonji domain ...	Pan troglodytes
ABK64187	99.9	jumonji domain-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029005	2.2e-73	40.1	KIAA1082
AB018285	2e-61	41.8	KIAA0742

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	1107	1206	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	999	1223	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	999	1223	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Primer_f	TGAAATACCTGGTGCTCTGTG
Primer_r	ACTCCATATTCTTCAAGCAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-