Order Kazusa clone(s) from : ![]() |
Product ID | ORK00251 |
---|---|
Accession No | AB046810 |
Description | kinesin family member 16B, transcript variant 1 |
Clone name | fj09048y1 |
Vector information | |
cDNA sequence | DNA sequence (4558 bp) Predicted protein sequence (1393 aa) |
HaloTag ORF Clone |
FHC00251
![]() |
Flexi ORF Clone | FXC00251 |
Source | Human fetal brain |
Rouge ID |
mKIAA1590
by Kazusa Mouse cDNA Project
|
Note | We replaced fj09048, former representative clones for KIAA1590 with fj09048y1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 303 bp |
---|---|
Genome contig ID | gi51511747r_16195488 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 16295488 | 16501996 | 23 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001752 | 94 | 115 | PR00380 | Kinesin |
IPR001752 | 215 | 232 | PR00380 | Kinesin | |
IPR001752 | 248 | 266 | PR00380 | Kinesin | |
IPR001752 | 309 | 330 | PR00380 | Kinesin | |
HMMPfam | IPR001752 | 10 | 360 | PF00225 | Kinesin |
IPR000253 | 479 | 545 | PF00498 | Forkhead-associated | |
HMMSmart | IPR001752 | 2 | 367 | SM00129 | Kinesin |
ProfileScan | IPR001752 | 1 | 278 | PS50067 | Kinesin |
ScanRegExp | IPR001752 | 247 | 258 | PS00411 | Kinesin |
IPR001220 | 446 | 452 | PS00307 | Legume lectin |
![]() |
Primer_f | GCCAAATGGAGTTCAGGTGTC |
---|---|
Primer_r | GTGTTCAGAAGGACTAGCGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |