KIAA1805

Product ID	ORK07483
Accession No	AB058708
Description	zinc finger protein 512
Clone name	fk00014
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3237 bp) Predicted protein sequence (534 aa)
Source	Human fetal brain
Rouge ID	mKIAA1805 by Kazusa Mouse cDNA Project

Length: 3237 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1630 bp
Genome contig ID	gi89161199f_27574446
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GTTTGGCAATGACAAAAGAAATAAATGACTCTCAG
Flanking genome sequence (125018 - 125067)	----+--------+--------+--------+--------+----* AAAGATGTTTCCAGTGTTCTTTGACGCCGACCTGCTGCATGACTCCTTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	27674446	27699462	12	100.0	Perfect prediction

Length: 534 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX00563	5.8e-211	100.0	zinc finger pro...	Homo sapiens
Q96ME7	5.8e-211	100.0	Zinc finger pro...	Homo sapiens
AAX93199	5.8e-211	100.0	unknown [Homo s...	Homo sapiens
Q5R6F3	1.2e-210	99.8	Zinc finger pro...	Pongo abelii
CAH92911	4e-210	99.6	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033022	1.2e-45	42.0	KIAA1196

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	164	187	PF00096	Zinc finger
	IPR007087	254	277	PF00096	Zinc finger
	IPR007087	407	430	PF00096	Zinc finger
HMMSmart	IPR015880	164	187	SM00355	Zinc finger
	IPR015880	254	277	SM00355	Zinc finger
	IPR015880	373	395	SM00355	Zinc finger
	IPR015880	407	430	SM00355	Zinc finger
ProfileScan	IPR007087	254	277	PS50157	Zinc finger
ProfileScan	IPR007087	407	435	PS50157	Zinc finger
ScanRegExp	IPR007087	166	187	PS00028	Zinc finger
	IPR007087	256	277	PS00028	Zinc finger
	IPR007087	409	430	PS00028	Zinc finger

Primer_f	GATTCTCTTCCCCATTTTGCG
Primer_r	AATTCAGGTTTCAGTGCTCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-