Order Kazusa clone(s) from : ![]() |
Product ID | ORK01640 |
---|---|
Accession No | AB067521 |
Description | paraneoplastic Ma antigen family member 5, transcript variant 3 |
Clone name | fk02059 |
Vector information | |
cDNA sequence | DNA sequence (3194 bp) Predicted protein sequence (452 aa) |
HaloTag ORF Clone |
FHC01640
![]() |
Flexi ORF Clone | FXC01640 |
Source | Human fetal brain |
Rouge ID |
mKIAA1934
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1425 bp |
---|---|
Genome contig ID | gi89161218r_151808027 |
PolyA signal sequence (AGTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AGGCAGCAGGGACATTTGAAC |
---|---|
Primer_r | GATGCTATTTGGTCTTGGTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |