Gene/Protein Characteristic Table for KIAA1934
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01640
Accession No AB067521
Description paraneoplastic Ma antigen family member 5, transcript variant 3
Clone name fk02059
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3194 bp)
Predicted protein sequence (452 aa)
Flexi ORF Clone FXC01640
Source Human fetal brain
Rouge ID mKIAA1934 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3194 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 1425 bp
Genome contig ID gi89161218r_151808027
PolyA signal sequence
(AGTAAA,-20)
+----*----+----*----+----*----+----
TTCATGTTTCTCTTCAGTAAATTTTGTTCAGTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCAGTGGTGTCTTGCCTCTGCTGTGTGAAACTGGGGTGGGAGGTGGTCTG
Features of the protein sequence
Description

Length: 452 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96PV4 1e-177 100.0 Paraneoplastic ...
Homo sapiens
AAI01113 4.3e-177 99.8 Paraneoplastic ...
Homo sapiens
BAH14475 8.8e-177 99.6 unnamed protein...
Homo sapiens
XP_001082427 5.1e-166 94.2 similar to para...
Macaca mulatta
EDL82842 2.3e-85 58.0 rCG19945 [Rattu...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB020690 1.4e-47 46.7 KIAA0883
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGGCAGCAGGGACATTTGAAC
Primer_r GATGCTATTTGGTCTTGGTTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp