Order Kazusa clone(s) from : ![]() |
Product ID | ORK04654 |
---|---|
Accession No | AB067477 |
Description | CUB and Sushi multiple domains 1 |
Clone name | fk02692 |
Vector information | |
cDNA sequence | DNA sequence (3289 bp) Predicted protein sequence (1048 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1890
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 142 bp |
---|---|
Genome contig ID | gi51511724r_2896176 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 2996176 | 3212178 | 21 | 100.0 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000436 | 81 | 136 | PF00084 | Sushi/SCR/CCP |
IPR000859 | 140 | 245 | PF00431 | CUB | |
IPR000436 | 253 | 309 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 313 | 419 | PF00431 | CUB | |
IPR000436 | 427 | 483 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 487 | 592 | PF00431 | CUB | |
IPR000436 | 600 | 657 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 661 | 766 | PF00431 | CUB | |
IPR000436 | 777 | 834 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 838 | 943 | PF00431 | CUB | |
IPR000436 | 951 | 1006 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 1010 | 1046 | PF00431 | CUB | |
HMMSmart | IPR000436 | 81 | 136 | SM00032 | Sushi/SCR/CCP |
IPR000859 | 140 | 248 | SM00042 | CUB | |
IPR000436 | 253 | 309 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 313 | 422 | SM00042 | CUB | |
IPR000436 | 427 | 483 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 487 | 595 | SM00042 | CUB | |
IPR000436 | 600 | 657 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 661 | 769 | SM00042 | CUB | |
IPR000436 | 777 | 834 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 838 | 946 | SM00042 | CUB | |
IPR000436 | 951 | 1006 | SM00032 | Sushi/SCR/CCP | |
ProfileScan | IPR000436 | 79 | 138 | PS50923 | Sushi/SCR/CCP |
IPR000859 | 140 | 248 | PS01180 | CUB | |
IPR000436 | 251 | 311 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 313 | 422 | PS01180 | CUB | |
IPR000436 | 425 | 485 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 487 | 595 | PS01180 | CUB | |
IPR000436 | 598 | 659 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 661 | 769 | PS01180 | CUB | |
IPR000436 | 775 | 836 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 838 | 946 | PS01180 | CUB | |
IPR000436 | 949 | 1008 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 1010 | 1048 | PS01180 | CUB | |
ScanRegExp | IPR001000 | 68 | 78 | PS00591 | Glycoside hydrolase |
![]() |
Primer_f | CCCAGCTATGACTTCCTACAC |
---|---|
Primer_r | GTCAAAACAAGCTTCCCGTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |