Order Kazusa clone(s) from : ![]() |
Product ID | ORK04568 |
---|---|
Accession No | AB075868 |
Description | cirrhosis, autosomal recessive 1A (cirhin) |
Clone name | fk07519s1 |
Vector information | |
cDNA sequence | DNA sequence (4183 bp) Predicted protein sequence (636 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1988
by Kazusa Mouse cDNA Project
|
Note | We replaced fk07519, former representative clones for KIAA1988 with fk07519s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2271 bp |
---|---|
Genome contig ID | gi51511732f_67624861 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (134387 - 134436) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 67724062 | 67759246 | 15 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 28 | 55 | PF00400 | WD40 repeat |
IPR001680 | 102 | 140 | PF00400 | WD40 repeat | |
IPR001680 | 146 | 183 | PF00400 | WD40 repeat | |
IPR001680 | 288 | 317 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 16 | 55 | SM00320 | WD40 repeat |
IPR001680 | 59 | 98 | SM00320 | WD40 repeat | |
IPR001680 | 101 | 140 | SM00320 | WD40 repeat | |
IPR001680 | 145 | 183 | SM00320 | WD40 repeat | |
IPR001680 | 192 | 233 | SM00320 | WD40 repeat | |
IPR001680 | 236 | 275 | SM00320 | WD40 repeat | |
IPR001680 | 287 | 324 | SM00320 | WD40 repeat | |
IPR001680 | 437 | 476 | SM00320 | WD40 repeat | |
IPR001680 | 481 | 523 | SM00320 | WD40 repeat | |
IPR001680 | 526 | 565 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 23 | 333 | PS50294 | WD40 repeat |
![]() |
Primer_f | CTTTAGTGCTGGGCTCAATGG |
---|---|
Primer_r | GATCCATCTTCACAACCAACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |