KIAA1988

Product ID	ORK04568
Accession No	AB075868
Description	cirrhosis, autosomal recessive 1A (cirhin)
Clone name	fk07519s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4183 bp) Predicted protein sequence (636 aa)
Source	Human fetal brain
Rouge ID	mKIAA1988 by Kazusa Mouse cDNA Project
Note	We replaced fk07519, former representative clones for KIAA1988 with fk07519s1. (2002/12/27)

Length: 4183 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2271 bp
Genome contig ID	gi51511732f_67624861
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAGTCTGGGCAACATGGTGAGACCCTGTCTCTAC
Flanking genome sequence (134387 - 134436)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAATATAAAAATTAGCTAGGTGTGGTGGAGCATGCCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	67724062	67759246	15	99.4	Perfect prediction

Length: 636 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW83257	100.0	cirrhosis, auto...	Homo sapiens
XP_511062	97.2	hypothetical pr...	Pan troglodytes
Q969X6	97.6	Cirhin.	Homo sapiens
BAB55251	97.5	unnamed protein...	Homo sapiens
BAC11214	97.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033087	1.1e-05	26.2	KIAA1261
AB046767	6.5e-05	25.7	KIAA1547
AB011168	0.0002	23.3	KIAA0596

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	28	55	PF00400	WD40 repeat
	IPR001680	102	140	PF00400	WD40 repeat
	IPR001680	146	183	PF00400	WD40 repeat
	IPR001680	288	317	PF00400	WD40 repeat
HMMSmart	IPR001680	16	55	SM00320	WD40 repeat
	IPR001680	59	98	SM00320	WD40 repeat
	IPR001680	101	140	SM00320	WD40 repeat
	IPR001680	145	183	SM00320	WD40 repeat
	IPR001680	192	233	SM00320	WD40 repeat
	IPR001680	236	275	SM00320	WD40 repeat
	IPR001680	287	324	SM00320	WD40 repeat
	IPR001680	437	476	SM00320	WD40 repeat
	IPR001680	481	523	SM00320	WD40 repeat
	IPR001680	526	565	SM00320	WD40 repeat
ProfileScan	IPR001680	23	333	PS50294	WD40 repeat

Primer_f	CTTTAGTGCTGGGCTCAATGG
Primer_r	GATCCATCTTCACAACCAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-