Gene/Protein Characteristic Table for KIAA1956
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00954
Accession No AB075836
Description zinc finger protein 418
Clone name fk08713
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3543 bp)
Predicted protein sequence (680 aa)
Flexi ORF Clone FXC00954
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 3543 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1371 bp
Genome contig ID gi42406306r_63025198
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
GTATCTAAGTCCTCAATAAACCCTATGTCTCATTT
Flanking genome sequence
(99866 - 99817)		 
----+----*----+----*----+----*----+----*----+----*
TCTTTCTTTCTTTCTTTTTTGAGATGGAGTTTCGCTCCTGTTGCCCAGGC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 63125064 63137143 5 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 680 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8TF45 0 100.0 Zinc finger pro...
 Homo sapiens
EAW72542 0 99.7 zinc finger pro...
 Homo sapiens
BAB71096 0 99.9 unnamed protein...
 Homo sapiens
BAH11579 0 99.7 unnamed protein...
 Homo sapiens
BAH14229 0 100.0 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040941 2.7e-85 51.0 KIAA1508
AB075827 3.5e-84 52.6 KIAA1947
AB046831 7.9e-82 42.9 KIAA1611
D31763 1.2e-78 41.2 KIAA0065
AB037770 4.2e-78 44.4 KIAA1349
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 262 285 PD000003 Zinc finger
IPR007087 290 313 PD000003 Zinc finger
IPR007087 318 341 PD000003 Zinc finger
IPR007087 346 369 PD000003 Zinc finger
IPR007087 374 397 PD000003 Zinc finger
IPR007087 402 425 PD000003 Zinc finger
IPR007087 430 453 PD000003 Zinc finger
IPR007087 458 481 PD000003 Zinc finger
IPR007087 486 509 PD000003 Zinc finger
IPR007087 514 537 PD000003 Zinc finger
IPR007087 542 565 PD000003 Zinc finger
IPR007087 570 590 PD000003 Zinc finger
IPR007087 595 618 PD000003 Zinc finger
IPR007087 623 646 PD000003 Zinc finger
IPR007087 651 674 PD000003 Zinc finger
HMMPfam IPR001909 9 49 PF01352 KRAB box
IPR007087 234 256 PF00096 Zinc finger
IPR007087 262 284 PF00096 Zinc finger
IPR007087 290 312 PF00096 Zinc finger
IPR007087 318 340 PF00096 Zinc finger
IPR007087 346 368 PF00096 Zinc finger
IPR007087 374 396 PF00096 Zinc finger
IPR007087 402 424 PF00096 Zinc finger
IPR007087 430 452 PF00096 Zinc finger
IPR007087 458 480 PF00096 Zinc finger
IPR007087 486 508 PF00096 Zinc finger
IPR007087 514 536 PF00096 Zinc finger
IPR007087 542 564 PF00096 Zinc finger
IPR007087 570 589 PF00096 Zinc finger
IPR007087 595 617 PF00096 Zinc finger
IPR007087 623 645 PF00096 Zinc finger
IPR007087 651 673 PF00096 Zinc finger
HMMSmart IPR001909 9 62 SM00349 KRAB box
IPR015880 86 108 SM00355 Zinc finger
IPR015880 234 256 SM00355 Zinc finger
IPR015880 262 284 SM00355 Zinc finger
IPR015880 290 312 SM00355 Zinc finger
IPR015880 318 340 SM00355 Zinc finger
IPR015880 346 368 SM00355 Zinc finger
IPR015880 374 396 SM00355 Zinc finger
IPR015880 402 424 SM00355 Zinc finger
IPR015880 430 452 SM00355 Zinc finger
IPR015880 458 480 SM00355 Zinc finger
IPR015880 486 508 SM00355 Zinc finger
IPR015880 514 536 SM00355 Zinc finger
IPR015880 542 564 SM00355 Zinc finger
IPR015880 570 589 SM00355 Zinc finger
IPR015880 595 617 SM00355 Zinc finger
IPR015880 623 645 SM00355 Zinc finger
IPR015880 651 673 SM00355 Zinc finger
ProfileScan IPR001909 9 95 PS50805 KRAB box
IPR007087 232 261 PS50157 Zinc finger
IPR007087 262 289 PS50157 Zinc finger
IPR007087 290 317 PS50157 Zinc finger
IPR007087 318 345 PS50157 Zinc finger
IPR007087 346 373 PS50157 Zinc finger
IPR007087 374 401 PS50157 Zinc finger
IPR007087 402 429 PS50157 Zinc finger
IPR007087 430 457 PS50157 Zinc finger
IPR007087 458 485 PS50157 Zinc finger
IPR007087 486 513 PS50157 Zinc finger
IPR007087 514 541 PS50157 Zinc finger
IPR007087 542 569 PS50157 Zinc finger
IPR007087 570 594 PS50157 Zinc finger
IPR007087 595 622 PS50157 Zinc finger
IPR007087 623 650 PS50157 Zinc finger
IPR007087 651 678 PS50157 Zinc finger
ScanRegExp IPR007087 88 109 PS00028 Zinc finger
IPR007087 234 256 PS00028 Zinc finger
IPR007087 264 284 PS00028 Zinc finger
IPR007087 292 312 PS00028 Zinc finger
IPR007087 320 340 PS00028 Zinc finger
IPR007087 348 368 PS00028 Zinc finger
IPR007087 376 396 PS00028 Zinc finger
IPR007087 404 424 PS00028 Zinc finger
IPR007087 432 452 PS00028 Zinc finger
IPR007087 460 480 PS00028 Zinc finger
IPR007087 488 508 PS00028 Zinc finger
IPR007087 516 536 PS00028 Zinc finger
IPR007087 544 564 PS00028 Zinc finger
IPR007087 597 617 PS00028 Zinc finger
IPR007087 625 645 PS00028 Zinc finger
IPR007087 653 673 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATCAGGGGACACATCACAAGC
Primer_r CCTCTGACACATGGAACTTAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp