KIAA0118

Product ID	ORK06560
Accession No	D42087
Description	RAB21, member RAS oncogene family
Clone name	ha00793
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1413 bp) Predicted protein sequence (161 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0118 by Kazusa Mouse cDNA Project

Length: 1413 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	927 bp
Genome contig ID	gi89161190f_70350638
PolyA signal sequence (None)	+--------+--------+----*----+---- TTATCTGCTTTTACAAGCGCAAGGTGCAAAAATAT
Flanking genome sequence (116011 - 116060)	----+--------+--------+--------+--------+----* ATACAATAGTCTCATTGATGACTGTAAAGTGAATTAACATTTGGTGATTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	70449880	70466647	6	100.0	Perfect prediction

Length: 161 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001117520	2e-66	100.0	similar to Ras-...	Macaca mulatta
XP_522469	2e-66	100.0	similar to GTP-...	Pan troglodytes
Q9UL25	2e-66	100.0	Ras-related pro...	Homo sapiens
P55745	7.2e-66	98.8	Ras-related pro...	Canis lupus fam...
XP_001490458	1.4e-65	98.1	similar to RAB2...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	59	72	PR00449	Ras GTPase
FPrintScan	IPR001806	94	116	PR00449	Ras GTPase
HMMPfam	IPR013753	1	118	PF00071	Ras
HMMSmart	IPR003578	1	119	SM00174	Ras small GTPase
	IPR003577	1	119	SM00173	Ras small GTPase
	IPR003579	1	119	SM00175	Ras small GTPase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGATAGAAACAGCACAAGTGG
Primer_r	TCCTGGCTAACCTGGTGAAAC
PCR product length	582 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles