KIAA0077

Product ID	ORK06520
Accession No	D38521
Description	proteasome (prosome, macropain) activator subunit 4
Clone name	ha00919
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6106 bp) Predicted protein sequence (1798 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0077 by Kazusa Mouse cDNA Project

Length: 6106 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	708 bp
Genome contig ID	gi89161199r_53845511
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATGTGTGATTTTAAAAATAAACAGCAACAACAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACCCTGACTGGCTGTTTTTTCCCTGTATTCTTTACAACTATTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	53945511	54051291	47	100.0	Perfect prediction

Length: 1798 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14997	100.0	Proteasome acti...	Homo sapiens
XP_606554	97.4	proteasome (pro...	Bos taurus
EDL98046	96.0	rCG23342, isofo...	Rattus norvegicus
XP_001055468	96.0	similar to prot...	Rattus norvegicus
Q5SSW2	95.9	Proteasome acti...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	1133	1170	PF02985	HEAT
	IPR000357	1309	1345	PF02985	HEAT
	IPR000357	1635	1671	PF02985	HEAT

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGCTGCTGGATTTAGGTGGTA
Primer_r	CATCAGGTCATTGGTTAGGTT
PCR product length	129 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles