Order Kazusa clone(s) from : ![]() |
Product ID | ORK00406 |
---|---|
Accession No | D42055 |
Description | neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase, transcript variant 1 |
Clone name | ha00935 |
Vector information | |
cDNA sequence | DNA sequence (5749 bp) Predicted protein sequence (927 aa) |
Flexi ORF Clone | FXC00406 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0093
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2964 bp |
---|---|
Genome contig ID | gi51511731r_53806423 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 53906423 | 54073127 | 29 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 63 | 75 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 93 | 106 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 48 | 134 | PF00168 | C2 calcium-dependent membrane targeting |
IPR001202 | 220 | 249 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 377 | 406 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 450 | 479 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 502 | 531 | PF00397 | WW/Rsp5/WWP | |
IPR000569 | 621 | 926 | PF00632 | HECT | |
HMMSmart | IPR000008 | 47 | 149 | SM00239 | C2 calcium-dependent membrane targeting |
IPR001202 | 219 | 251 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 376 | 408 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 449 | 481 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 501 | 533 | SM00456 | WW/Rsp5/WWP | |
IPR000569 | 590 | 926 | SM00119 | HECT | |
ProfileScan | IPR000008 | 48 | 134 | PS50004 | C2 calcium-dependent membrane targeting |
IPR001202 | 218 | 251 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 375 | 408 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 448 | 481 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 500 | 533 | PS50020 | WW/Rsp5/WWP | |
IPR000569 | 592 | 926 | PS50237 | HECT | |
ScanRegExp | IPR001202 | 224 | 249 | PS01159 | WW/Rsp5/WWP |
IPR001202 | 381 | 406 | PS01159 | WW/Rsp5/WWP | |
IPR001202 | 454 | 479 | PS01159 | WW/Rsp5/WWP | |
IPR001202 | 506 | 531 | PS01159 | WW/Rsp5/WWP |
Panel name | Genebridge 4 |
---|---|
Primer_f | TGTGCTATGCTCTGGGGTAAG |
Primer_r | TGCTGATGCTGTGGTGTTTGG |
PCR product length | 491 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |