Gene/Protein Characteristic Table for KIAA0065
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00392
Accession No D31763
Description zinc finger protein 33A, transcript variant 2
Clone name ha00946
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (6041 bp)
Predicted protein sequence (848 aa)
Flexi ORF Clone FXC00392
Source Myeloblast cell line (KG-1)
Features of the cloned cDNA sequence
Description

Length: 6041 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 848 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_521451 0 98.5 zinc finger pro...
Pan troglodytes
Q06730 0 100.0 Zinc finger pro...
Homo sapiens
NP_008885 0 99.9 zinc finger pro...
Homo sapiens
EAW85889 0 99.8 zinc finger pro...
Homo sapiens
BAF85533 0 99.6 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 7.5e-90 44.7 KIAA1611
AB058755 9.7e-88 42.5 KIAA1852
AB037770 2.2e-86 45.1 KIAA1349
AB107355 7.4e-86 45.6 KIAA2033
AB018341 5.9e-81 46.0 KIAA0798
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 366 389 PD000003 Zinc finger
IPR007087 394 417 PD000003 Zinc finger
IPR007087 422 445 PD000003 Zinc finger
IPR007087 450 473 PD000003 Zinc finger
IPR007087 478 501 PD000003 Zinc finger
IPR007087 506 528 PD000003 Zinc finger
IPR007087 534 557 PD000003 Zinc finger
IPR007087 562 585 PD000003 Zinc finger
IPR007087 590 613 PD000003 Zinc finger
IPR007087 618 641 PD000003 Zinc finger
IPR007087 646 668 PD000003 Zinc finger
IPR007087 674 697 PD000003 Zinc finger
IPR007087 702 725 PD000003 Zinc finger
IPR007087 730 753 PD000003 Zinc finger
IPR007087 760 781 PD000003 Zinc finger
IPR007087 786 808 PD000003 Zinc finger
HMMPfam IPR001909 50 90 PF01352 KRAB box
IPR007087 366 388 PF00096 Zinc finger
IPR007087 394 416 PF00096 Zinc finger
IPR007087 422 444 PF00096 Zinc finger
IPR007087 450 472 PF00096 Zinc finger
IPR007087 478 500 PF00096 Zinc finger
IPR007087 506 528 PF00096 Zinc finger
IPR007087 534 556 PF00096 Zinc finger
IPR007087 562 584 PF00096 Zinc finger
IPR007087 590 612 PF00096 Zinc finger
IPR007087 618 640 PF00096 Zinc finger
IPR007087 646 668 PF00096 Zinc finger
IPR007087 674 696 PF00096 Zinc finger
IPR007087 702 724 PF00096 Zinc finger
IPR007087 730 752 PF00096 Zinc finger
IPR007087 758 780 PF00096 Zinc finger
IPR007087 786 808 PF00096 Zinc finger
HMMSmart IPR001909 50 110 SM00349 KRAB box
IPR015880 366 388 SM00355 Zinc finger
IPR015880 394 416 SM00355 Zinc finger
IPR015880 422 444 SM00355 Zinc finger
IPR015880 450 472 SM00355 Zinc finger
IPR015880 478 500 SM00355 Zinc finger
IPR015880 506 528 SM00355 Zinc finger
IPR015880 534 556 SM00355 Zinc finger
IPR015880 562 584 SM00355 Zinc finger
IPR015880 590 612 SM00355 Zinc finger
IPR015880 618 640 SM00355 Zinc finger
IPR015880 646 668 SM00355 Zinc finger
IPR015880 674 696 SM00355 Zinc finger
IPR015880 702 724 SM00355 Zinc finger
IPR015880 730 752 SM00355 Zinc finger
IPR015880 758 780 SM00355 Zinc finger
IPR015880 786 808 SM00355 Zinc finger
ProfileScan IPR001909 50 121 PS50805 KRAB box
IPR007087 366 393 PS50157 Zinc finger
IPR007087 394 421 PS50157 Zinc finger
IPR007087 422 449 PS50157 Zinc finger
IPR007087 450 477 PS50157 Zinc finger
IPR007087 478 505 PS50157 Zinc finger
IPR007087 506 533 PS50157 Zinc finger
IPR007087 534 561 PS50157 Zinc finger
IPR007087 562 589 PS50157 Zinc finger
IPR007087 590 617 PS50157 Zinc finger
IPR007087 618 645 PS50157 Zinc finger
IPR007087 646 673 PS50157 Zinc finger
IPR007087 674 701 PS50157 Zinc finger
IPR007087 702 729 PS50157 Zinc finger
IPR007087 730 757 PS50157 Zinc finger
IPR007087 758 785 PS50157 Zinc finger
IPR007087 786 813 PS50157 Zinc finger
ScanRegExp IPR007087 368 388 PS00028 Zinc finger
IPR007087 396 416 PS00028 Zinc finger
IPR007087 424 444 PS00028 Zinc finger
IPR007087 452 472 PS00028 Zinc finger
IPR007087 480 500 PS00028 Zinc finger
IPR007087 508 528 PS00028 Zinc finger
IPR007087 536 556 PS00028 Zinc finger
IPR007087 564 584 PS00028 Zinc finger
IPR007087 592 612 PS00028 Zinc finger
IPR007087 620 640 PS00028 Zinc finger
IPR007087 648 668 PS00028 Zinc finger
IPR007087 676 696 PS00028 Zinc finger
IPR007087 704 724 PS00028 Zinc finger
IPR007087 732 752 PS00028 Zinc finger
IPR007087 758 780 PS00028 Zinc finger
IPR007087 788 808 PS00028 Zinc finger
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name Genebridge 4
Primer_f GAGAATGGAAAACAGTGAACG
Primer_r CTTCCACAGGCTCCCCAATCA
PCR product length 151 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp