KIAA0048

Product ID	ORK00384
Accession No	D28588
Description	Sp2 transcription factor
Clone name	ha01311
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3288 bp) Predicted protein sequence (627 aa)
HaloTag ORF Clone	FHC00384
Flexi ORF Clone	FXC00384
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0048 by Kazusa Mouse cDNA Project

Length: 3288 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1133 bp
Genome contig ID	gi51511734f_43229973
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- TGCTAATAAATTTAGTTGCCTGAGGCAAAATCTTC
Flanking genome sequence (131349 - 131398)	----+--------+--------+--------+--------+----* AACTTGGCAGTTCGGCTTCCTTTGTCTTTTCCCTTGGAGAGCTCGGAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	43329973	43361320	7	99.3	Perfect prediction

Length: 627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q02086	7.1e-182	100.0	Transcription f...	Homo sapiens
XP_511930	1.2e-181	99.8	Sp2 transcripti...	Pan troglodytes
XP_001083602	1.5e-181	99.7	similar to Sp2 ...	Macaca mulatta
AAH16680	3.2e-180	100.0	Sp2 transcripti...	Homo sapiens
XP_001173433	5.5e-180	99.8	Sp2 transcripti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023189	0.00022	44.9	KIAA0972
AB011129	0.00028	24.2	KIAA0557
AB075842	0.00049	44.3	KIAA1962
AB075836	0.00066	36.7	KIAA1956
AB095928	0.00066	41.1	KIAA2007

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	569	594	PD000003	Zinc finger
BlastProDom	IPR007087	599	621	PD000003	Zinc finger
HMMPfam	IPR007087	539	563	PF00096	Zinc finger
	IPR007087	569	593	PF00096	Zinc finger
	IPR007087	599	621	PF00096	Zinc finger
HMMSmart	IPR015880	539	563	SM00355	Zinc finger
	IPR015880	569	593	SM00355	Zinc finger
	IPR015880	599	621	SM00355	Zinc finger
ProfileScan	IPR007087	539	568	PS50157	Zinc finger
	IPR007087	569	598	PS50157	Zinc finger
	IPR007087	599	626	PS50157	Zinc finger
ScanRegExp	IPR007087	541	563	PS00028	Zinc finger
	IPR007087	571	593	PS00028	Zinc finger
	IPR007087	601	621	PS00028	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TTCCTTTCCTTGTTATTCACC
Primer_r	AGGTGCTGTTATCTGAATCCA
PCR product length	151 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles