KIAA0248

Product ID	ORK00476
Accession No	D87435
Description	golgi brefeldin A resistant guanine nucleotide exchange factor 1, transcript variant 1
Clone name	ha02775s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6360 bp) Predicted protein sequence (1880 aa)
HaloTag ORF Clone	FHC00476
Flexi ORF Clone	FXC00476
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0248 by Kazusa Mouse cDNA Project
Note	We replaced ha02775, former representative clones for KIAA0248 with ha02775s1. (2002/5/10)

Length: 6360 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	556 bp
Genome contig ID	gi89161187f_103895315
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGGACTTTTTATGATATAATAAATGTCTTAGTACC
Flanking genome sequence (237326 - 237375)	----+--------+--------+--------+--------+----* AGCATCATTGTCTCTCCCTCCGGTTTCCTTCTTGAGCTTGTGGGTCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	103995315	104132639	40	99.9	Perfect prediction

Length: 1880 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_521592	99.5	golgi-specific ...	Pan troglodytes
XP_001104407	99.0	golgi-specific ...	Macaca mulatta
BAG09674	100.0	Golgi-specific ...	synthetic construct
Q92538	99.9	Golgi-specific ...	Homo sapiens
AAI17683	99.7	GBF1 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029033	5.1e-09	33.0	KIAA1110
AB018306	9.4e-09	37.7	KIAA0763
AB011094	1.5e-08	34.6	KIAA0522
AB023159	2.8e-05	26.1	KIAA0942
AB095931	0.00037	30.9	KIAA2011

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000904	717	905	PF01369	SEC7-like
HMMSmart	IPR000904	717	905	SM00222	SEC7-like
ProfileScan	IPR000904	713	903	PS50190	SEC7-like

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGTTTCCCACTCCCATTAGCC
Primer_r	CCATGGTGCCAGTCAACTCTC
PCR product length	94 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles