KIAA0137

Product ID	ORK00422
Accession No	D50927
Description	tousled-like kinase 1, transcript variant 1
Clone name	ha02915s1
Vector information	The cDNA fragment was originally inserted at the EcoRV-NotI ... The cDNA fragment was originally inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328) without using any linker or adapter and its SalI-NotI fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. Original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4122 bp) Predicted protein sequence (801 aa)
HaloTag ORF Clone	FHC00422
Flexi ORF Clone	FXC00422
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0137 by Kazusa Mouse cDNA Project
Note	We replaced ha02915, former representative clones for KIAA0137 with ha02915s1. (2002/5/10)

Length: 4122 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1716 bp
Genome contig ID	gi89161199r_171456816
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAAAATCAGCTGAATAAATTCCTTAAGTATACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGACAAGTGTAAATTGTTTCAAGCTGTTAAAGTTAAACCTAATAACCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	171556816	171725289	21	99.5	Perfect prediction

Length: 801 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKI8	100.0	Serine/threonin...	Homo sapiens
AAX41019	100.0	tousled-like ki...	synthetic construct
BAF85197	99.9	unnamed protein...	Homo sapiens
XP_535959	99.5	similar to tous...	Canis lupus fam...
XP_001927925	99.5	tousled-like ki...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018265	1.4e-08	30.0	KIAA0722
AB014523	2e-07	31.3	KIAA0623
AB023190	1.2e-05	32.1	KIAA0973
AB002301	1.9e-05	29.3	KIAA0303
AB018350	2e-05	31.8	KIAA0807

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	502	767	PD000001	Protein kinase
HMMPfam	IPR000719	491	769	PF00069	Protein kinase
HMMSmart	IPR001245	491	767	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	491	769	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	491	769	PS50011	Protein kinase
ScanRegExp	IPR000719	497	520	PS00107	Protein kinase
ScanRegExp	IPR008271	617	629	PS00108	Serine/threonine protein kinase

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	ATCCCCTACACCCCCTTCTTC
Primer_r	GTCATCCTTCCTTCACTGCTC
PCR product length	277 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles