KIAA0202

Product ID	ORK00456
Accession No	D86957
Description	septin 8, transcript variant 2
Clone name	ha02944
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4344 bp) Predicted protein sequence (508 aa)
HaloTag ORF Clone	FHC00456
Flexi ORF Clone	FXC00456
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0202 by Kazusa Mouse cDNA Project

Length: 4344 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2816 bp
Genome contig ID	gi51511721r_132019596
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACTTATTTTTTTCATTAAATTTTGCATTTATTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTTTTGTGGTGTCTTTTTTGGGCAGTAGCTTTTCTGATTTAACGTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	132119596	132140966	10	99.3	Perfect prediction

Length: 508 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAO13879	8e-164	100.0	septin SEPT8_v2...	Homo sapiens
AAH49819	1.3e-140	96.7	Sept8 protein [...	Mus musculus
EDL33585	7.6e-136	91.7	septin 8, isofo...	Mus musculus
EAW62316	2.8e-135	100.0	hCG24127, isofo...	Homo sapiens
Q92599	3.1e-135	100.0	Septin-8.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50918	2.2e-69	77.7	KIAA0128
D63878	3.1e-25	41.2	KIAA0158
AB023208	3.4e-25	41.2	KIAA0991

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	226	279	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	120	392	PF00735	Cell division/GTP binding protein

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTAGGTGGTTTGTAATTGTGC
Primer_r	AAAACAGTCAATGAATGCAGG
PCR product length	190 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles