KIAA0223

Product ID	ORK00468
Accession No	D86976
Description	histocompatibility (minor) HA-1, transcript variant 1
Clone name	ha02995
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4121 bp) Predicted protein sequence (1165 aa)
HaloTag ORF Clone	FHC00468
Flexi ORF Clone	FXC00468
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0223 by Kazusa Mouse cDNA Project

Length: 4121 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	622 bp
Genome contig ID	gi42406306f_918317
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTTTATTTTGCTGAAATAAAAAGTTTTTAATCGGG
Flanking genome sequence (119312 - 119361)	----+--------+--------+--------+--------+----* TGTTTTCTGTGGCAGCTGCAAGCTTAGAAGATTTTCTGTGGCAGCTGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	1018317	1037627	23	100.0	Perfect prediction

Length: 1165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92619	100.0	Minor histocomp...	Homo sapiens
AAH65223	99.7	Histocompatibil...	Homo sapiens
BAG62086	99.6	unnamed protein...	Homo sapiens
AAH35564	98.1	HMHA1 protein [...	Homo sapiens
Q5RB40	94.9	Minor histocomp...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040911	0.00037	29.4	KIAA1478

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	732	779	PF00130	Protein kinase C
HMMPfam	IPR000198	804	976	PF00620	RhoGAP
HMMSmart	IPR001060	303	390	SM00055	Cdc15/Fes/CIP4
	IPR002219	730	776	SM00109	Protein kinase C
	IPR000198	801	1000	SM00324	RhoGAP
ProfileScan	IPR002219	731	776	PS50081	Protein kinase C
ProfileScan	IPR000198	790	1003	PS50238	RhoGAP
ScanRegExp	IPR002219	732	776	PS00479	Protein kinase C

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGTTTCCAGGGTGCAGTACAG
Primer_r	AGACCCCACTGTGTACCTGAG
PCR product length	103 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles