|
Order Kazusa clone(s) from : |
| Product ID | ORK00449 |
|---|---|
| Accession No | D80012 |
| Description | ubiquitin specific peptidase 10 |
| Clone name | ha03225 |
| Vector information | |
| cDNA sequence | DNA sequence (3280 bp) Predicted protein sequence (813 aa) |
|
HaloTag ORF Clone |
FHC00449
|
| Flexi ORF Clone | FXC00449 |
| Source | Myeloblast cell line (KG-1) |
| Rouge ID |
mKIAA0190
by Kazusa Mouse cDNA Project
|
Length: 3280 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 837 bp |
|---|---|
| Genome contig ID | gi51511732f_83191152 |
| PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (179876 - 179925) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 16 | f | 83291152 | 83371026 | 14 | 100.0 | Perfect prediction |
Length: 813 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Chromosome No. 14
Experimental conditions| Panel name | Genebridge 4 |
|---|---|
| Primer_f | TCGCGGAGTCCCAATGAAACG |
| Primer_r | AGGAAGCTCAACTGAAGATCG |
| PCR product length | 124 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |