KIAA0190

Product ID	ORK00449
Accession No	D80012
Description	ubiquitin specific peptidase 10
Clone name	ha03225
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3280 bp) Predicted protein sequence (813 aa)
HaloTag ORF Clone	FHC00449
Flexi ORF Clone	FXC00449
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0190 by Kazusa Mouse cDNA Project

Length: 3280 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	837 bp
Genome contig ID	gi51511732f_83191152
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTGTCGCCCATCAATAAAAATCACAAAGTTGGTTT
Flanking genome sequence (179876 - 179925)	----+--------+--------+--------+--------+----* AAAGGTGTGTGCGTGTTTCTTTGAATGCGAATGCCTTTTCGGGTAACTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	83291152	83371026	14	100.0	Perfect prediction

Length: 813 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW95471	100.0	ubiquitin speci...	Homo sapiens
CAD97644	99.9	hypothetical pr...	Homo sapiens
T47164	99.9	yb53b03.r1 Stra...	Homo sapiens
BAG09644	100.0	ubiquitin carbo...	synthetic construct
XP_001111197	98.0	ubiquitin speci...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29956	2.3e-05	25.6	KIAA0055
AB020698	0.00061	35.4	KIAA0891

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009818	93	110	PF07145	Ataxin-2
HMMPfam	IPR001394	427	807	PF00443	Peptidase C19
ProfileScan	IPR001394	430	811	PS50235	Peptidase C19
ScanRegExp	IPR001394	431	446	PS00972	Peptidase C19
ScanRegExp	IPR001394	747	765	PS00973	Peptidase C19

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TCGCGGAGTCCCAATGAAACG
Primer_r	AGGAAGCTCAACTGAAGATCG
PCR product length	124 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles