KIAA0158

Product ID	ORK00436
Accession No	D63878
Description	septin 2, transcript variant 4
Clone name	ha03233
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3433 bp) Predicted protein sequence (367 aa)
HaloTag ORF Clone	FHC00436
Flexi ORF Clone	FXC00436
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0158 by Kazusa Mouse cDNA Project

Length: 3433 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2089 bp
Genome contig ID	gi89161199f_241803458
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACCTTTTATCAATAAAGCACTATTGTTTAGATATT
Flanking genome sequence (138656 - 138705)	----+--------+--------+--------+--------+----* AAATGAGTATTTCTCTTGGTTATTTGCAAGGGAAAGTTGTGAGGTTTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	241903458	241942112	13	99.4	Perfect prediction

Length: 367 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_516208	6e-143	100.0	septin 2 [Pan t...	Pan troglodytes
BAG57759	6e-143	100.0	unnamed protein...	Homo sapiens
Q15019	1.1e-140	100.0	Septin-2; Neura...	Homo sapiens
Q5RA66	2e-140	99.7	Septin-2.	Pongo abelii
AAH14455	5.5e-140	99.7	Septin 2 [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023208	1.6e-49	46.5	KIAA0991
D86957	8.2e-43	41.2	KIAA0202
D50918	7.3e-42	41.1	KIAA0128

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	149	205	PD002565	Cell division/GTP binding protein
FPrintScan	IPR008113	75	92	PR01740	Septin 2
	IPR008113	195	203	PR01740	Septin 2
	IPR008113	232	242	PR01740	Septin 2
HMMPfam	IPR000038	40	319	PF00735	Cell division/GTP binding protein

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GTAGGGAGATGGAGAAAATGC
Primer_r	ACAGTGAAGGGCAAAGTTAGC
PCR product length	162 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles