Order Kazusa clone(s) from : ![]() |
Product ID | ORK00425 |
---|---|
Accession No | D50931 |
Description | KIAA0141, transcript variant 1 |
Clone name | ha03721 |
Vector information | |
cDNA sequence | DNA sequence (3020 bp) Predicted protein sequence (536 aa) |
HaloTag ORF Clone |
FHC00425
![]() |
Flexi ORF Clone | FXC00425 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0141
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1392 bp |
---|---|
Genome contig ID | gi51511721f_141183611 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (116291 - 116340) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 141283611 | 141299900 | 12 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006597 | 266 | 297 | PF08238 | Sel1-like |
IPR006597 | 298 | 333 | PF08238 | Sel1-like | |
IPR006597 | 334 | 371 | PF08238 | Sel1-like | |
IPR006597 | 372 | 405 | PF08238 | Sel1-like | |
IPR006597 | 406 | 441 | PF08238 | Sel1-like | |
HMMSmart | IPR006597 | 266 | 297 | SM00671 | Sel1-like |
IPR006597 | 298 | 333 | SM00671 | Sel1-like | |
IPR006597 | 334 | 371 | SM00671 | Sel1-like | |
IPR006597 | 372 | 405 | SM00671 | Sel1-like | |
IPR006597 | 406 | 441 | SM00671 | Sel1-like |
Panel name | Genebridge 4 |
---|---|
Primer_f | ACAGTCAAGAAGAGGAAAGTG |
Primer_r | GTAGGAGGGCAGACACCATTG |
PCR product length | 140 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |