KIAA0277

Product ID	ORK00490
Accession No	D87467
Description	Rap guanine nucleotide exchange factor (GEF) 5
Clone name	ha06833
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5900 bp) Predicted protein sequence (583 aa)
HaloTag ORF Clone	FHC00490
Flexi ORF Clone	FXC00490
Source	Human adult brain
Rouge ID	mKIAA0277 by Kazusa Mouse cDNA Project

Length: 5900 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4102 bp
Genome contig ID	gi89161213r_22024447
PolyA signal sequence (None)	+--------+--------+----*----+---- TGCTTTTCCAAATATGAGACTATGTTAAAGACACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCATGCCTCTTAGTTTCTTGCTTTCTCTGTGATGTGTGTGGATTAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	22124447	22199859	16	99.2	Perfect prediction

Length: 583 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92565	100.0	Rap guanine nuc...	Homo sapiens
EAW93745	98.6	hCG38228, isofo...	Homo sapiens
XP_539466	97.2	similar to Rap ...	Canis lupus fam...
P83900	95.3	Rap guanine nuc...	Rattus norvegicus
AAH46627	94.8	Rapgef5 protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002311	3.2e-26	29.3	KIAA0313
AB002349	5.2e-12	27.1	KIAA0351
AB020653	1.5e-08	26.5	KIAA0846
AB023176	2.9e-05	27.9	KIAA0959

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000651	74	178	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
HMMPfam	IPR001895	345	529	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR000651	70	204	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
HMMSmart	IPR001895	344	583	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR000651	71	204	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
ProfileScan	IPR001895	348	582	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001895	497	526	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGCCCTGCGAGTCTGTTCTAG
Primer_r	TGTTGGACCACTGCGGAAGAC
PCR product length	144 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles