Gene/Protein Characteristic Table for KIAA0296
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07504
Accession No AB002294
Description zinc finger protein 646
Clone name hf00260
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7604 bp)
Predicted protein sequence (1838 aa)
Source Human adult brain
Rouge ID mKIAA0296 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 7604 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1838 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15015 0 100.0 Zinc finger pro...
Homo sapiens
EAW52171 0 99.9 zinc finger pro...
Homo sapiens
XP_001156078 0 99.3 zinc finger pro...
Pan troglodytes
NP_055514 0 100.0 zinc finger pro...
Homo sapiens
AAH35589 0 99.9 Zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037760 7e-11 32.4 KIAA1339
AB075827 9.2e-11 27.1 KIAA1947
AB058709 1.4e-10 27.3 KIAA1806
AB058730 1.7e-10 26.9 KIAA1827
AB023232 4.6e-08 25.7 KIAA1015
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 17 40 PF00096 Zinc finger
IPR007087 57 79 PF00096 Zinc finger
IPR007087 84 106 PF00096 Zinc finger
IPR007087 248 270 PF00096 Zinc finger
IPR007087 275 297 PF00096 Zinc finger
IPR007087 303 325 PF00096 Zinc finger
IPR007087 383 405 PF00096 Zinc finger
IPR007087 410 432 PF00096 Zinc finger
IPR007087 474 496 PF00096 Zinc finger
IPR007087 501 523 PF00096 Zinc finger
IPR007087 584 606 PF00096 Zinc finger
IPR007087 626 648 PF00096 Zinc finger
IPR007087 857 879 PF00096 Zinc finger
IPR007087 1061 1083 PF00096 Zinc finger
IPR007087 1088 1110 PF00096 Zinc finger
IPR007087 1212 1234 PF00096 Zinc finger
IPR007087 1239 1261 PF00096 Zinc finger
IPR007087 1267 1289 PF00096 Zinc finger
IPR007087 1308 1330 PF00096 Zinc finger
IPR007087 1335 1357 PF00096 Zinc finger
IPR007087 1373 1395 PF00096 Zinc finger
IPR007087 1594 1616 PF00096 Zinc finger
IPR007087 1686 1708 PF00096 Zinc finger
IPR007087 1713 1735 PF00096 Zinc finger
IPR007087 1741 1763 PF00096 Zinc finger
IPR007087 1770 1792 PF00096 Zinc finger
HMMSmart IPR015880 17 40 SM00355 Zinc finger
IPR015880 57 79 SM00355 Zinc finger
IPR015880 84 106 SM00355 Zinc finger
IPR015880 248 270 SM00355 Zinc finger
IPR015880 275 297 SM00355 Zinc finger
IPR015880 303 325 SM00355 Zinc finger
IPR015880 383 405 SM00355 Zinc finger
IPR015880 410 432 SM00355 Zinc finger
IPR015880 474 496 SM00355 Zinc finger
IPR015880 501 523 SM00355 Zinc finger
IPR015880 584 606 SM00355 Zinc finger
IPR015880 626 648 SM00355 Zinc finger
IPR015880 653 675 SM00355 Zinc finger
IPR015880 830 852 SM00355 Zinc finger
IPR015880 857 879 SM00355 Zinc finger
IPR015880 890 913 SM00355 Zinc finger
IPR015880 967 987 SM00355 Zinc finger
IPR015880 1061 1083 SM00355 Zinc finger
IPR015880 1088 1110 SM00355 Zinc finger
IPR015880 1212 1234 SM00355 Zinc finger
IPR015880 1239 1261 SM00355 Zinc finger
IPR015880 1267 1289 SM00355 Zinc finger
IPR015880 1308 1330 SM00355 Zinc finger
IPR015880 1335 1357 SM00355 Zinc finger
IPR015880 1373 1395 SM00355 Zinc finger
IPR015880 1540 1560 SM00355 Zinc finger
IPR015880 1566 1588 SM00355 Zinc finger
IPR015880 1594 1616 SM00355 Zinc finger
IPR015880 1686 1708 SM00355 Zinc finger
IPR015880 1713 1735 SM00355 Zinc finger
IPR015880 1741 1763 SM00355 Zinc finger
IPR015880 1770 1792 SM00355 Zinc finger
ProfileScan IPR007087 17 45 PS50157 Zinc finger
IPR007087 57 79 PS50157 Zinc finger
IPR007087 84 111 PS50157 Zinc finger
IPR007087 248 271 PS50157 Zinc finger
IPR007087 275 302 PS50157 Zinc finger
IPR007087 303 330 PS50157 Zinc finger
IPR007087 383 411 PS50157 Zinc finger
IPR007087 410 437 PS50157 Zinc finger
IPR007087 474 496 PS50157 Zinc finger
IPR007087 501 523 PS50157 Zinc finger
IPR007087 584 611 PS50157 Zinc finger
IPR007087 626 648 PS50157 Zinc finger
IPR007087 653 680 PS50157 Zinc finger
IPR007087 830 852 PS50157 Zinc finger
IPR007087 857 884 PS50157 Zinc finger
IPR007087 890 918 PS50157 Zinc finger
IPR007087 1061 1083 PS50157 Zinc finger
IPR007087 1088 1115 PS50157 Zinc finger
IPR007087 1212 1234 PS50157 Zinc finger
IPR007087 1239 1266 PS50157 Zinc finger
IPR007087 1267 1294 PS50157 Zinc finger
IPR007087 1308 1330 PS50157 Zinc finger
IPR007087 1335 1362 PS50157 Zinc finger
IPR007087 1373 1400 PS50157 Zinc finger
IPR007087 1594 1621 PS50157 Zinc finger
IPR007087 1686 1709 PS50157 Zinc finger
IPR007087 1713 1740 PS50157 Zinc finger
IPR007087 1741 1768 PS50157 Zinc finger
IPR007087 1770 1797 PS50157 Zinc finger
ScanRegExp IPR007087 19 40 PS00028 Zinc finger
IPR007087 59 79 PS00028 Zinc finger
IPR007087 86 106 PS00028 Zinc finger
IPR007087 250 270 PS00028 Zinc finger
IPR007087 277 297 PS00028 Zinc finger
IPR007087 305 325 PS00028 Zinc finger
IPR007087 385 405 PS00028 Zinc finger
IPR007087 412 433 PS00028 Zinc finger
IPR007087 476 496 PS00028 Zinc finger
IPR007087 503 523 PS00028 Zinc finger
IPR007087 586 606 PS00028 Zinc finger
IPR007087 628 648 PS00028 Zinc finger
IPR007087 655 675 PS00028 Zinc finger
IPR007087 832 852 PS00028 Zinc finger
IPR007087 859 879 PS00028 Zinc finger
IPR007087 892 913 PS00028 Zinc finger
IPR007087 1063 1083 PS00028 Zinc finger
IPR007087 1090 1110 PS00028 Zinc finger
IPR007087 1214 1234 PS00028 Zinc finger
IPR007087 1241 1261 PS00028 Zinc finger
IPR007087 1269 1289 PS00028 Zinc finger
IPR007087 1310 1330 PS00028 Zinc finger
IPR007087 1337 1357 PS00028 Zinc finger
IPR007087 1375 1395 PS00028 Zinc finger
IPR007087 1568 1588 PS00028 Zinc finger
IPR007087 1596 1616 PS00028 Zinc finger
IPR007087 1688 1708 PS00028 Zinc finger
IPR007087 1715 1735 PS00028 Zinc finger
IPR007087 1742 1763 PS00028 Zinc finger
IPR007087 1772 1792 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TTTGGGGGGCAGCAGTTTTCC
Primer_r AGGGAGAGGTGGATGCAGAGC
PCR conditions 95 °C30 sec66 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f TTTGGGGGGCAGCAGTTTTCC
Primer_r AGGGAGAGGTGGATGCAGAGC
PCR product length 144 bp
PCR conditions 95 °C15 sec68 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp