Order Kazusa clone(s) from : ![]() |
Product ID | ORK07504 |
---|---|
Accession No | AB002294 |
Description | zinc finger protein 646 |
Clone name | hf00260 |
Vector information | |
cDNA sequence | DNA sequence (7604 bp) Predicted protein sequence (1838 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0296
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 17 | 40 | PF00096 | Zinc finger |
IPR007087 | 57 | 79 | PF00096 | Zinc finger | |
IPR007087 | 84 | 106 | PF00096 | Zinc finger | |
IPR007087 | 248 | 270 | PF00096 | Zinc finger | |
IPR007087 | 275 | 297 | PF00096 | Zinc finger | |
IPR007087 | 303 | 325 | PF00096 | Zinc finger | |
IPR007087 | 383 | 405 | PF00096 | Zinc finger | |
IPR007087 | 410 | 432 | PF00096 | Zinc finger | |
IPR007087 | 474 | 496 | PF00096 | Zinc finger | |
IPR007087 | 501 | 523 | PF00096 | Zinc finger | |
IPR007087 | 584 | 606 | PF00096 | Zinc finger | |
IPR007087 | 626 | 648 | PF00096 | Zinc finger | |
IPR007087 | 857 | 879 | PF00096 | Zinc finger | |
IPR007087 | 1061 | 1083 | PF00096 | Zinc finger | |
IPR007087 | 1088 | 1110 | PF00096 | Zinc finger | |
IPR007087 | 1212 | 1234 | PF00096 | Zinc finger | |
IPR007087 | 1239 | 1261 | PF00096 | Zinc finger | |
IPR007087 | 1267 | 1289 | PF00096 | Zinc finger | |
IPR007087 | 1308 | 1330 | PF00096 | Zinc finger | |
IPR007087 | 1335 | 1357 | PF00096 | Zinc finger | |
IPR007087 | 1373 | 1395 | PF00096 | Zinc finger | |
IPR007087 | 1594 | 1616 | PF00096 | Zinc finger | |
IPR007087 | 1686 | 1708 | PF00096 | Zinc finger | |
IPR007087 | 1713 | 1735 | PF00096 | Zinc finger | |
IPR007087 | 1741 | 1763 | PF00096 | Zinc finger | |
IPR007087 | 1770 | 1792 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 17 | 40 | SM00355 | Zinc finger |
IPR015880 | 57 | 79 | SM00355 | Zinc finger | |
IPR015880 | 84 | 106 | SM00355 | Zinc finger | |
IPR015880 | 248 | 270 | SM00355 | Zinc finger | |
IPR015880 | 275 | 297 | SM00355 | Zinc finger | |
IPR015880 | 303 | 325 | SM00355 | Zinc finger | |
IPR015880 | 383 | 405 | SM00355 | Zinc finger | |
IPR015880 | 410 | 432 | SM00355 | Zinc finger | |
IPR015880 | 474 | 496 | SM00355 | Zinc finger | |
IPR015880 | 501 | 523 | SM00355 | Zinc finger | |
IPR015880 | 584 | 606 | SM00355 | Zinc finger | |
IPR015880 | 626 | 648 | SM00355 | Zinc finger | |
IPR015880 | 653 | 675 | SM00355 | Zinc finger | |
IPR015880 | 830 | 852 | SM00355 | Zinc finger | |
IPR015880 | 857 | 879 | SM00355 | Zinc finger | |
IPR015880 | 890 | 913 | SM00355 | Zinc finger | |
IPR015880 | 967 | 987 | SM00355 | Zinc finger | |
IPR015880 | 1061 | 1083 | SM00355 | Zinc finger | |
IPR015880 | 1088 | 1110 | SM00355 | Zinc finger | |
IPR015880 | 1212 | 1234 | SM00355 | Zinc finger | |
IPR015880 | 1239 | 1261 | SM00355 | Zinc finger | |
IPR015880 | 1267 | 1289 | SM00355 | Zinc finger | |
IPR015880 | 1308 | 1330 | SM00355 | Zinc finger | |
IPR015880 | 1335 | 1357 | SM00355 | Zinc finger | |
IPR015880 | 1373 | 1395 | SM00355 | Zinc finger | |
IPR015880 | 1540 | 1560 | SM00355 | Zinc finger | |
IPR015880 | 1566 | 1588 | SM00355 | Zinc finger | |
IPR015880 | 1594 | 1616 | SM00355 | Zinc finger | |
IPR015880 | 1686 | 1708 | SM00355 | Zinc finger | |
IPR015880 | 1713 | 1735 | SM00355 | Zinc finger | |
IPR015880 | 1741 | 1763 | SM00355 | Zinc finger | |
IPR015880 | 1770 | 1792 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 17 | 45 | PS50157 | Zinc finger |
IPR007087 | 57 | 79 | PS50157 | Zinc finger | |
IPR007087 | 84 | 111 | PS50157 | Zinc finger | |
IPR007087 | 248 | 271 | PS50157 | Zinc finger | |
IPR007087 | 275 | 302 | PS50157 | Zinc finger | |
IPR007087 | 303 | 330 | PS50157 | Zinc finger | |
IPR007087 | 383 | 411 | PS50157 | Zinc finger | |
IPR007087 | 410 | 437 | PS50157 | Zinc finger | |
IPR007087 | 474 | 496 | PS50157 | Zinc finger | |
IPR007087 | 501 | 523 | PS50157 | Zinc finger | |
IPR007087 | 584 | 611 | PS50157 | Zinc finger | |
IPR007087 | 626 | 648 | PS50157 | Zinc finger | |
IPR007087 | 653 | 680 | PS50157 | Zinc finger | |
IPR007087 | 830 | 852 | PS50157 | Zinc finger | |
IPR007087 | 857 | 884 | PS50157 | Zinc finger | |
IPR007087 | 890 | 918 | PS50157 | Zinc finger | |
IPR007087 | 1061 | 1083 | PS50157 | Zinc finger | |
IPR007087 | 1088 | 1115 | PS50157 | Zinc finger | |
IPR007087 | 1212 | 1234 | PS50157 | Zinc finger | |
IPR007087 | 1239 | 1266 | PS50157 | Zinc finger | |
IPR007087 | 1267 | 1294 | PS50157 | Zinc finger | |
IPR007087 | 1308 | 1330 | PS50157 | Zinc finger | |
IPR007087 | 1335 | 1362 | PS50157 | Zinc finger | |
IPR007087 | 1373 | 1400 | PS50157 | Zinc finger | |
IPR007087 | 1594 | 1621 | PS50157 | Zinc finger | |
IPR007087 | 1686 | 1709 | PS50157 | Zinc finger | |
IPR007087 | 1713 | 1740 | PS50157 | Zinc finger | |
IPR007087 | 1741 | 1768 | PS50157 | Zinc finger | |
IPR007087 | 1770 | 1797 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 19 | 40 | PS00028 | Zinc finger |
IPR007087 | 59 | 79 | PS00028 | Zinc finger | |
IPR007087 | 86 | 106 | PS00028 | Zinc finger | |
IPR007087 | 250 | 270 | PS00028 | Zinc finger | |
IPR007087 | 277 | 297 | PS00028 | Zinc finger | |
IPR007087 | 305 | 325 | PS00028 | Zinc finger | |
IPR007087 | 385 | 405 | PS00028 | Zinc finger | |
IPR007087 | 412 | 433 | PS00028 | Zinc finger | |
IPR007087 | 476 | 496 | PS00028 | Zinc finger | |
IPR007087 | 503 | 523 | PS00028 | Zinc finger | |
IPR007087 | 586 | 606 | PS00028 | Zinc finger | |
IPR007087 | 628 | 648 | PS00028 | Zinc finger | |
IPR007087 | 655 | 675 | PS00028 | Zinc finger | |
IPR007087 | 832 | 852 | PS00028 | Zinc finger | |
IPR007087 | 859 | 879 | PS00028 | Zinc finger | |
IPR007087 | 892 | 913 | PS00028 | Zinc finger | |
IPR007087 | 1063 | 1083 | PS00028 | Zinc finger | |
IPR007087 | 1090 | 1110 | PS00028 | Zinc finger | |
IPR007087 | 1214 | 1234 | PS00028 | Zinc finger | |
IPR007087 | 1241 | 1261 | PS00028 | Zinc finger | |
IPR007087 | 1269 | 1289 | PS00028 | Zinc finger | |
IPR007087 | 1310 | 1330 | PS00028 | Zinc finger | |
IPR007087 | 1337 | 1357 | PS00028 | Zinc finger | |
IPR007087 | 1375 | 1395 | PS00028 | Zinc finger | |
IPR007087 | 1568 | 1588 | PS00028 | Zinc finger | |
IPR007087 | 1596 | 1616 | PS00028 | Zinc finger | |
IPR007087 | 1688 | 1708 | PS00028 | Zinc finger | |
IPR007087 | 1715 | 1735 | PS00028 | Zinc finger | |
IPR007087 | 1742 | 1763 | PS00028 | Zinc finger | |
IPR007087 | 1772 | 1792 | PS00028 | Zinc finger |
![]() |
---|
Primer_f | TTTGGGGGGCAGCAGTTTTCC |
---|---|
Primer_r | AGGGAGAGGTGGATGCAGAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTTGGGGGGCAGCAGTTTTCC |
Primer_r | AGGGAGAGGTGGATGCAGAGC |
PCR product length | 144 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |