Gene/Protein Characteristic Table for KIAA0313
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00500
Accession No AB002311
Description Rap guanine nucleotide exchange factor (GEF) 2
Clone name hg00186
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6568 bp)
Predicted protein sequence (1508 aa)
Flexi ORF Clone FXC00500
Source Human adult brain
Rouge ID mKIAA0313 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6568 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1508 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y4G8 0 100.0 Rap guanine nuc...
Homo sapiens
XP_001147382 0 100.0 Rap guanine nuc...
Pan troglodytes
AAI17322 0 99.9 RAPGEF2 protein...
Homo sapiens
AAY40909 0 100.0 unknown [Homo s...
Homo sapiens
XP_001498881 0 98.3 similar to Rap ...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D87467 1.1e-14 29.5 KIAA0277
AB002349 2.9e-05 27.2 KIAA0351
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000595 163 249 PF00027 Cyclic nucleotide-binding
IPR000651 279 366 PF00618 Guanine nucleotide exchange factor for Ras-like GTPases
IPR001478 419 473 PF00595 PDZ/DHR/GLGF
IPR000159 615 701 PF00788 Ras-association
IPR001895 723 908 PF00617 Guanine-nucleotide dissociation stimulator CDC25
HMMSmart IPR000595 144 262 SM00100 Cyclic nucleotide-binding
IPR000651 276 389 SM00229 Guanine nucleotide exchange factor for Ras-like GTPases
IPR001478 404 476 SM00228 PDZ/DHR/GLGF
IPR000159 615 701 SM00314 Ras-association
IPR001895 722 959 SM00147 Guanine-nucleotide dissociation stimulator CDC25
ProfileScan IPR000595 144 244 PS50042 Cyclic nucleotide-binding
IPR000651 276 389 PS50212 Guanine nucleotide exchange factor for Ras-like GTPases
IPR001478 394 464 PS50106 PDZ/DHR/GLGF
IPR000159 615 701 PS50200 Ras-association
IPR001895 726 953 PS50009 Guanine-nucleotide dissociation stimulator CDC25
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TGCACTTGACATCACAGAGCG
Primer_r GAAATCTAGCTCTACCACAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f TGCACTTGACATCACAGAGCG
Primer_r GAAATCTAGCTCTACCACAAG
PCR product length 102 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp