Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00500 |
---|---|
Accession No | AB002311 |
Description | Rap guanine nucleotide exchange factor (GEF) 2 |
Clone name | hg00186 |
Vector information | |
cDNA sequence | DNA sequence (6568 bp) Predicted protein sequence (1508 aa) |
HaloTag ORF Clone |
FHC00500
|
Flexi ORF Clone | FXC00500 |
Source | Human adult brain |
Rouge ID |
mKIAA0313
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000595 | 163 | 249 | PF00027 | Cyclic nucleotide-binding |
IPR000651 | 279 | 366 | PF00618 | Guanine nucleotide exchange factor for Ras-like GTPases | |
IPR001478 | 419 | 473 | PF00595 | PDZ/DHR/GLGF | |
IPR000159 | 615 | 701 | PF00788 | Ras-association | |
IPR001895 | 723 | 908 | PF00617 | Guanine-nucleotide dissociation stimulator CDC25 | |
HMMSmart | IPR000595 | 144 | 262 | SM00100 | Cyclic nucleotide-binding |
IPR000651 | 276 | 389 | SM00229 | Guanine nucleotide exchange factor for Ras-like GTPases | |
IPR001478 | 404 | 476 | SM00228 | PDZ/DHR/GLGF | |
IPR000159 | 615 | 701 | SM00314 | Ras-association | |
IPR001895 | 722 | 959 | SM00147 | Guanine-nucleotide dissociation stimulator CDC25 | |
ProfileScan | IPR000595 | 144 | 244 | PS50042 | Cyclic nucleotide-binding |
IPR000651 | 276 | 389 | PS50212 | Guanine nucleotide exchange factor for Ras-like GTPases | |
IPR001478 | 394 | 464 | PS50106 | PDZ/DHR/GLGF | |
IPR000159 | 615 | 701 | PS50200 | Ras-association | |
IPR001895 | 726 | 953 | PS50009 | Guanine-nucleotide dissociation stimulator CDC25 |
RT-PCR |
---|
Primer_f | TGCACTTGACATCACAGAGCG |
---|---|
Primer_r | GAAATCTAGCTCTACCACAAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGCACTTGACATCACAGAGCG |
Primer_r | GAAATCTAGCTCTACCACAAG |
PCR product length | 102 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |