Order Kazusa clone(s) from : ![]() |
Product ID | ORK01971 |
---|---|
Accession No | AB002316 |
Description | RIMS binding protein 2 |
Clone name | hg00364 |
Vector information | |
cDNA sequence | DNA sequence (6322 bp) Predicted protein sequence (1106 aa) |
HaloTag ORF Clone |
FHC01971
![]() |
Flexi ORF Clone | FXC01971 |
Source | Human adult brain |
Rouge ID |
mKIAA0318
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 226 | 283 | PD000066 | Src homology-3 |
IPR001452 | 907 | 965 | PD000066 | Src homology-3 | |
IPR001452 | 1012 | 1069 | PD000066 | Src homology-3 | |
FPrintScan | IPR001452 | 905 | 915 | PR00452 | Src homology-3 |
IPR001452 | 927 | 942 | PR00452 | Src homology-3 | |
IPR001452 | 1059 | 1071 | PR00452 | Src homology-3 | |
HMMPfam | IPR011511 | 235 | 286 | PF07653 | Variant SH3 |
IPR003961 | 351 | 431 | PF00041 | Fibronectin | |
IPR003961 | 445 | 517 | PF00041 | Fibronectin | |
IPR003961 | 541 | 627 | PF00041 | Fibronectin | |
IPR011511 | 906 | 968 | PF07653 | Variant SH3 | |
IPR011511 | 1010 | 1071 | PF07653 | Variant SH3 | |
HMMSmart | IPR001452 | 224 | 287 | SM00326 | Src homology-3 |
IPR003961 | 351 | 431 | SM00060 | Fibronectin | |
IPR003961 | 445 | 517 | SM00060 | Fibronectin | |
IPR003961 | 541 | 627 | SM00060 | Fibronectin | |
IPR001452 | 905 | 969 | SM00326 | Src homology-3 | |
IPR001452 | 1009 | 1072 | SM00326 | Src homology-3 | |
ProfileScan | IPR001452 | 221 | 288 | PS50002 | Src homology-3 |
IPR003961 | 352 | 440 | PS50853 | Fibronectin | |
IPR003961 | 444 | 527 | PS50853 | Fibronectin | |
IPR003961 | 540 | 637 | PS50853 | Fibronectin | |
IPR001452 | 902 | 970 | PS50002 | Src homology-3 | |
IPR001452 | 1006 | 1073 | PS50002 | Src homology-3 |
![]() |
---|
Primer_f | CCACACAGAGCTTAACCACAC |
---|---|
Primer_r | GCTGGCAGATGTATTTGATGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCACACAGAGCTTAACCACAC |
Primer_r | GCTGGCAGATGTATTTGATGG |
PCR product length | 236 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |