Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01971 |
---|---|
Accession No | AB002316 |
Description | RIMS binding protein 2 |
Clone name | hg00364 |
Vector information | |
cDNA sequence | DNA sequence (6322 bp) Predicted protein sequence (1106 aa) |
HaloTag ORF Clone |
FHC01971
|
Flexi ORF Clone | FXC01971 |
Source | Human adult brain |
Rouge ID |
mKIAA0318
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 226 | 283 | PD000066 | Src homology-3 |
IPR001452 | 907 | 965 | PD000066 | Src homology-3 | |
IPR001452 | 1012 | 1069 | PD000066 | Src homology-3 | |
FPrintScan | IPR001452 | 905 | 915 | PR00452 | Src homology-3 |
IPR001452 | 927 | 942 | PR00452 | Src homology-3 | |
IPR001452 | 1059 | 1071 | PR00452 | Src homology-3 | |
HMMPfam | IPR011511 | 235 | 286 | PF07653 | Variant SH3 |
IPR003961 | 351 | 431 | PF00041 | Fibronectin | |
IPR003961 | 445 | 517 | PF00041 | Fibronectin | |
IPR003961 | 541 | 627 | PF00041 | Fibronectin | |
IPR011511 | 906 | 968 | PF07653 | Variant SH3 | |
IPR011511 | 1010 | 1071 | PF07653 | Variant SH3 | |
HMMSmart | IPR001452 | 224 | 287 | SM00326 | Src homology-3 |
IPR003961 | 351 | 431 | SM00060 | Fibronectin | |
IPR003961 | 445 | 517 | SM00060 | Fibronectin | |
IPR003961 | 541 | 627 | SM00060 | Fibronectin | |
IPR001452 | 905 | 969 | SM00326 | Src homology-3 | |
IPR001452 | 1009 | 1072 | SM00326 | Src homology-3 | |
ProfileScan | IPR001452 | 221 | 288 | PS50002 | Src homology-3 |
IPR003961 | 352 | 440 | PS50853 | Fibronectin | |
IPR003961 | 444 | 527 | PS50853 | Fibronectin | |
IPR003961 | 540 | 637 | PS50853 | Fibronectin | |
IPR001452 | 902 | 970 | PS50002 | Src homology-3 | |
IPR001452 | 1006 | 1073 | PS50002 | Src homology-3 |
RT-PCR |
---|
Primer_f | CCACACAGAGCTTAACCACAC |
---|---|
Primer_r | GCTGGCAGATGTATTTGATGG |
PCR conditions | 95 °C15 sec55 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCACACAGAGCTTAACCACAC |
Primer_r | GCTGGCAGATGTATTTGATGG |
PCR product length | 236 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |