KIAA0817

Product ID	ORK00645
Accession No	AB011541
Description	multiple EGF-like-domains 8, transcript variant 2
Clone name	hg01392s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9984 bp) Predicted protein sequence (2785 aa)
HaloTag ORF Clone	FHC00645
Flexi ORF Clone	FXC00645
Source	Human adult brain
Rouge ID	mKIAA0817 by Kazusa Mouse cDNA Project
Note	We replaced hg01392, former representative clones for KIAA0817 with hg01392s2. (1998/8/22)

Length: 9984 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1012 bp
Genome contig ID	gi42406306f_47421601
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAACCTGGGTGACAGAGCGAGACTCCACCTC
Flanking genome sequence (152179 - 152228)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAATTTAAGAGGTCACTCAGTTGTGCTGTGGAGAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	47521601	47573778	41	99.8	Perfect prediction

Length: 2785 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA32469	100.0	MEGF8 [Homo sap...	Homo sapiens
AAI53881	100.0	Multiple EGF-li...	Homo sapiens
XP_194337	94.4	multiple EGF-li...	Mus musculus
AAP35084	97.2	EGF domain-cont...	Homo sapiens
Q7Z7M0	97.6	Multiple epider...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011106	2.6e-07	22.4	KIAA0534
AB053450	1e-05	22.4	KIAA1776

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000859	57	144	PF00431	CUB
	IPR013111	181	209	PF07974	EGF
	IPR006652	285	332	PF01344	Kelch repeat type 1
	IPR006652	454	505	PF01344	Kelch repeat type 1
	IPR002165	889	944	PF01437	Plexin
	IPR002165	945	1013	PF01437	Plexin
	IPR013091	1014	1054	PF07645	EGF calcium-binding
	IPR002049	1103	1148	PF00053	EGF-like
	IPR002049	1151	1199	PF00053	EGF-like
	IPR006652	1505	1553	PF01344	Kelch repeat type 1
	IPR006652	1611	1662	PF01344	Kelch repeat type 1
	IPR006652	1724	1763	PF01344	Kelch repeat type 1
	IPR002049	2209	2242	PF00053	EGF-like
HMMSmart	IPR000859	40	147	SM00042	CUB
	IPR006210	148	177	SM00181	EGF
	IPR006210	180	210	SM00181	EGF
	IPR003659	568	620	SM00423	Plexin/semaphorin/integrin
	IPR003659	787	839	SM00423	Plexin/semaphorin/integrin
	IPR003659	840	887	SM00423	Plexin/semaphorin/integrin
	IPR003659	889	931	SM00423	Plexin/semaphorin/integrin
	IPR003659	945	1013	SM00423	Plexin/semaphorin/integrin
	IPR001881	1014	1055	SM00179	EGF-like calcium-binding
	IPR006210	1017	1055	SM00181	EGF
	IPR006210	1057	1100	SM00181	EGF
	IPR002049	1103	1148	SM00180	EGF-like
	IPR006210	1110	1149	SM00181	EGF
	IPR006210	1150	1200	SM00181	EGF
	IPR002049	1151	1199	SM00180	EGF-like
	IPR006210	1346	1385	SM00181	EGF
	IPR006210	1388	1421	SM00181	EGF
	IPR003659	1816	1856	SM00423	Plexin/semaphorin/integrin
	IPR003659	1864	1919	SM00423	Plexin/semaphorin/integrin
	IPR003659	2000	2058	SM00423	Plexin/semaphorin/integrin
	IPR003659	2060	2117	SM00423	Plexin/semaphorin/integrin
	IPR001881	2118	2160	SM00179	EGF-like calcium-binding
	IPR006210	2121	2160	SM00181	EGF
	IPR006210	2162	2190	SM00181	EGF
	IPR002049	2178	2239	SM00180	EGF-like
	IPR006210	2200	2240	SM00181	EGF
	IPR006210	2241	2304	SM00181	EGF
	IPR002049	2244	2317	SM00180	EGF-like
	IPR006210	2328	2382	SM00181	EGF
ProfileScan	IPR000859	37	147	PS01180	CUB
	IPR000742	177	210	PS50026	EGF-like
	IPR000742	1014	1055	PS50026	EGF-like
	IPR002049	1103	1150	PS50027	EGF-like
	IPR002049	1151	1201	PS50027	EGF-like
	IPR000859	1203	1345	PS01180	CUB
	IPR000742	1343	1385	PS50026	EGF-like
	IPR000742	2118	2156	PS50026	EGF-like
	IPR002049	2193	2241	PS50027	EGF-like
	IPR002049	2320	2383	PS50027	EGF-like
ScanRegExp	IPR013032	165	176	PS00022	EGF-like region
	IPR013032	165	176	PS01186	EGF-like region
	IPR013032	198	209	PS00022	EGF-like region
	IPR013032	198	209	PS01186	EGF-like region
	IPR001304	788	812	PS00615	C-type lectin
	IPR001881	1014	1040	PS01187	EGF-like calcium-binding
	IPR000152	1031	1042	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	1040	1054	PS01186	EGF-like region
	IPR002049	1119	1153	PS01248	EGF-like
	IPR013032	1171	1182	PS00022	EGF-like region
	IPR002049	1171	1203	PS01248	EGF-like
	IPR013032	1373	1384	PS00022	EGF-like region
	IPR013032	1373	1384	PS01186	EGF-like region
	IPR013032	1409	1420	PS00022	EGF-like region
	IPR013032	1409	1420	PS01186	EGF-like region
	IPR000152	2135	2146	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	2144	2159	PS01186	EGF-like region
	IPR013032	2178	2189	PS00022	EGF-like region
	IPR013032	2178	2193	PS01186	EGF-like region
	IPR002049	2210	2242	PS01248	EGF-like
	IPR002049	2291	2322	PS01248	EGF-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	8	MALGKVLAMALVLALAVLGSLSP	30	PRIMARY	23
SOSUI2	2	2588	LFVFFSVFFSCFFLFLSLCVLLW	2610	PRIMARY	23

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	nakayama
Primer_f	GATGGGGCCTCCTTTGTTCTG
Primer_r	GTCTCTTGGTTCCTGCTTTGC
PCR product length	98 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles