Order Kazusa clone(s) from : ![]() |
Product ID | ORK00057 |
---|---|
Accession No | AB002349 |
Description | Ral GEF with PH domain and SH3 binding motif 1, transcript variant 1 |
Clone name | hg01609 |
Vector information | |
cDNA sequence | DNA sequence (6336 bp) Predicted protein sequence (590 aa) |
HaloTag ORF Clone |
FHC00057
![]() |
Flexi ORF Clone | FXC00057 |
Source | Human adult brain |
Rouge ID |
mKIAA0351
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4395 bp |
---|---|
Genome contig ID | gi89161216f_128616874 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (408392 - 408441) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 128716874 | 129025264 | 19 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001895 | 80 | 271 | PF00617 | Guanine-nucleotide dissociation stimulator CDC25 |
IPR001849 | 465 | 576 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001895 | 79 | 323 | SM00147 | Guanine-nucleotide dissociation stimulator CDC25 |
IPR001849 | 465 | 578 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001895 | 83 | 322 | PS50009 | Guanine-nucleotide dissociation stimulator CDC25 |
IPR001849 | 464 | 576 | PS50003 | Pleckstrin-like |
![]() |
---|
Primer_f | TTACTGCGGGTGAGACGATTC |
---|---|
Primer_r | ATCTGTTGCACTCTCCTGGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTACTGCGGGTGAGACGATTC |
Primer_r | ATCTGTTGCACTCTCCTGGGC |
PCR product length | 102 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |