KIAA0351

Product ID	ORK00057
Accession No	AB002349
Description	Ral GEF with PH domain and SH3 binding motif 1, transcript variant 1
Clone name	hg01609
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6336 bp) Predicted protein sequence (590 aa)
HaloTag ORF Clone	FHC00057
Flexi ORF Clone	FXC00057
Source	Human adult brain
Rouge ID	mKIAA0351 by Kazusa Mouse cDNA Project

Length: 6336 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4395 bp
Genome contig ID	gi89161216f_128616874
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTGTTTACTTTGAAATTAAATGTGTTTTCCAATG
Flanking genome sequence (408392 - 408441)	----+--------+--------+--------+--------+----* AATGTTGCTCAGTTTATTAAAGTCACACACATTCACTTAGCAAACAGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	128716874	129025264	19	99.3	Perfect prediction

Length: 590 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001096712	0	98.8	similar to Ral ...	Macaca mulatta
Q5JS13	0	100.0	Ras-specific gu...	Homo sapiens
XP_873225	0	98.2	similar to Ral ...	Bos taurus
XP_001366247	2e-210	93.8	similar to Ral ...	Monodelphis dom...
XP_851594	5.7e-170	93.2	similar to Ral ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87467	1.5e-10	27.1	KIAA0277
AB023176	5.3e-10	29.8	KIAA0959
AB037729	6.3e-10	26.2	KIAA1308
AB020653	1.3e-09	28.8	KIAA0846
AB002311	3.1e-09	27.2	KIAA0313

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001895	80	271	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMPfam	IPR001849	465	576	PF00169	Pleckstrin-like
HMMSmart	IPR001895	79	323	SM00147	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR001849	465	578	SM00233	Pleckstrin-like
ProfileScan	IPR001895	83	322	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR001849	464	576	PS50003	Pleckstrin-like

Primer_f	TTACTGCGGGTGAGACGATTC
Primer_r	ATCTGTTGCACTCTCCTGGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTACTGCGGGTGAGACGATTC
Primer_r	ATCTGTTGCACTCTCCTGGGC
PCR product length	102 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles