KIAA0352

Product ID	ORK00512
Accession No	AB002350
Description	zinc finger and BTB domain containing 39
Clone name	hg01642
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6170 bp) Predicted protein sequence (721 aa)
HaloTag ORF Clone	FHC00512
Flexi ORF Clone	FXC00512
Source	Human adult brain
Rouge ID	mKIAA0352 by Kazusa Mouse cDNA Project

Length: 6170 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3945 bp
Genome contig ID	gi89161190r_55578905
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTTTTTATTTAGAATAAAAAAAGAAATTTGAAATG
Flanking genome sequence (99980 - 99931)	----+--------+--------+--------+--------+----* AGAGTTCTCTTCCTACCTACTATGAATATGCTCATACCTGGAGTTCAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	55678885	55686497	2	99.0	Perfect prediction

Length: 721 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15060	100.0	Zinc finger and...	Homo sapiens
XP_522441	99.2	zinc finger and...	Pan troglodytes
XP_001115523	97.6	zinc finger and...	Macaca mulatta
XP_001488157	93.5	similar to Zinc...	Equus caballus
EDL24521	88.9	zinc finger and...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075834	2.2e-08	27.7	KIAA1954
AB037809	4.3e-07	26.6	KIAA1388
AB058730	7.1e-05	26.8	KIAA1827
AB051490	8.4e-05	23.7	KIAA1703
AB023178	0.00012	27.5	KIAA0961

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	29	135	PF00651	BTB/POZ
	IPR007087	517	539	PF00096	Zinc finger
	IPR007087	614	636	PF00096	Zinc finger
	IPR007087	642	664	PF00096	Zinc finger
HMMSmart	IPR000210	39	135	SM00225	BTB/POZ-like
	IPR015880	381	403	SM00355	Zinc finger
	IPR015880	409	429	SM00355	Zinc finger
	IPR015880	460	483	SM00355	Zinc finger
	IPR015880	489	511	SM00355	Zinc finger
	IPR015880	517	539	SM00355	Zinc finger
	IPR015880	547	569	SM00355	Zinc finger
	IPR015880	614	636	SM00355	Zinc finger
	IPR015880	642	664	SM00355	Zinc finger
	IPR015880	670	692	SM00355	Zinc finger
ProfileScan	IPR000210	39	105	PS50097	BTB/POZ-like
	IPR007087	517	544	PS50157	Zinc finger
	IPR007087	547	569	PS50157	Zinc finger
	IPR007087	614	641	PS50157	Zinc finger
	IPR007087	642	669	PS50157	Zinc finger
	IPR007087	670	697	PS50157	Zinc finger
ScanRegExp	IPR007087	383	403	PS00028	Zinc finger
	IPR007087	519	539	PS00028	Zinc finger
	IPR007087	549	569	PS00028	Zinc finger
	IPR007087	616	636	PS00028	Zinc finger
	IPR007087	644	664	PS00028	Zinc finger

Primer_f	GAGGTAATTTCATAGGAGCTG
Primer_r	ACGTCGCACATGGTCTCTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAGGTAATTTCATAGGAGCTG
Primer_r	ACGTCGCACATGGTCTCTGAG
PCR product length	121 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles