KIAA0529

Product ID	ORK00553
Accession No	AB011101
Description	ubiquitin specific peptidase 15, transcript variant 2
Clone name	hg02898s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a synthetic oligonucleotide (1-52) was subcloned upstream of the cDNA (53- 4602). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGT-5' end of cDNA.
cDNA sequence	DNA sequence (4602 bp) Predicted protein sequence (952 aa)
HaloTag ORF Clone	FHC00553
Flexi ORF Clone	FXC00553
Source	Human adult brain
Rouge ID	mKIAA0529 by Kazusa Mouse cDNA Project
Note	We replaced hg02898, former representative clones for KIAA0529 with hg02898s1. (2002/5/10)

Length: 4602 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1743 bp
Genome contig ID	gi89161190f_60840463
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTATATAGATTTCAATAAAGCTATTCAAGGCCTT
Flanking genome sequence (245704 - 245753)	----+--------+--------+--------+--------+----* ATTTAGTCTTTTATTTCTTACTCTTAATCTTTTAATAAAAATCCCCTACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	60940463	61086165	21	99.9	Perfect prediction

Length: 952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001166420	99.9	ubiquitin speci...	Pan troglodytes
AAI25124	99.9	Ubiquitin speci...	Homo sapiens
AAI05522	98.7	Ubiquitin speci...	Bos taurus
EDM16533	98.1	ubiquitin speci...	Rattus norvegicus
AAF14188	97.9	deubiquitinatin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020698	1.1e-42	35.5	KIAA0891
D29956	5.8e-31	41.8	KIAA0055
AB029020	6.5e-15	23.9	KIAA1097
AB023220	5.2e-14	23.5	KIAA1003
AB033029	8.3e-09	43.6	KIAA1203

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010460	78	223	PF06337	Ubiquitin carboxyl-terminal hydrolase
HMMPfam	IPR001394	257	901	PF00443	Peptidase C19
HMMSmart	IPR006615	23	121	SM00695	Ubiquitin carboxyl-terminal hydrolase
ProfileScan	IPR001394	260	905	PS50235	Peptidase C19
ScanRegExp	IPR001394	261	276	PS00972	Peptidase C19
ScanRegExp	IPR001394	846	863	PS00973	Peptidase C19

Primer_f	TTCTTTGTGTGTTCCTGATGG
Primer_r	CCTGGATCCTTGAATGTGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCTTTGTGTGTTCCTGATGG
Primer_r	CCTGGATCCTTGAATGTGGTG
PCR product length	168 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles