Order Kazusa clone(s) from : ![]() |
Product ID | ORK01670 |
---|---|
Accession No | AB011092 |
Description | adenylate cyclase 9 |
Clone name | hg02989s1 |
Vector information | |
cDNA sequence | DNA sequence (7544 bp) Predicted protein sequence (1364 aa) |
HaloTag ORF Clone |
FHC01670
![]() |
Flexi ORF Clone | FXC01670 |
Source | Human adult brain |
Rouge ID |
mKIAA0520
by Kazusa Mouse cDNA Project
|
Note | We replaced hg01313 and hg02989, former representative clones for KIAA0520 with hg02989s1. (2002/5/10,2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3102 bp |
---|---|
Genome contig ID | gi51511732r_3852654 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 3952654 | 4106029 | 12 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001054 | 396 | 584 | PF00211 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 1060 | 1255 | PF00211 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
HMMSmart | IPR001054 | 336 | 558 | SM00044 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 1034 | 1238 | SM00044 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
ProfileScan | IPR001054 | 405 | 532 | PS50125 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 1069 | 1209 | PS50125 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
ScanRegExp | IPR001054 | 509 | 532 | PS00452 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 1186 | 1209 | PS00452 | Adenylyl cyclase class-3/4/guanylyl cyclase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 128 | RYALFYIGFACLLWSIYFAVHMR | 150 | PRIMARY | 23 | 2 | 154 | IVMVAPALCFLLVCVGFFLFTFT | 176 | PRIMARY | 23 | 3 | 187 | SLALTLLVFALTLAAQFQVLTPV | 209 | SECONDARY | 23 | 4 | 242 | LFLLYTVMHLPLYLSLCLGVAYS | 264 | PRIMARY | 23 | 5 | 295 | RGLLHGCIHAIGVHLFVMSQVR | 316 | SECONDARY | 22 | 6 | 796 | FSSLLDVFLSTTVFLTLSTTCFL | 818 | SECONDARY | 23 | 7 | 840 | LLEVLSLAVSIRMVFFLEDVMAC | 862 | PRIMARY | 23 | 8 | 876 | RHCIGAILVSLPALAVYSHVTSE | 898 | PRIMARY | 23 | 9 | 902 | NIHFPVFTGSAALIAVVHYCNFC | 924 | SECONDARY | 23 | 10 | 930 | MRSSLATVVGAGPLLLLYVSLCP | 952 | PRIMARY | 23 | 11 | 986 | ASLIGQEVVLVFFLLLLLVWFLN | 1008 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | ACAGTCGGTTCTTGCTAATTC |
---|---|
Primer_r | TGCTTCCTGTCACATGGGCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACAGTCGGTTCTTGCTAATTC |
Primer_r | TGCTTCCTGTCACATGGGCTG |
PCR product length | 157 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |