KIAA0531

Product ID	ORK01087
Accession No	AB011103
Description	kinesin family member 5C, transcript variant 1
Clone name	hg03072
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6927 bp) Predicted protein sequence (999 aa)
HaloTag ORF Clone	FHC01087
Flexi ORF Clone	FXC01087
Source	Human adult brain
Rouge ID	mKIAA0531 by Kazusa Mouse cDNA Project

Length: 6927 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3685 bp
Genome contig ID	gi89161199f_149249289
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACTAAAAGTGGAAAATAAAATTGAATTAAACTTTG
Flanking genome sequence (342232 - 342281)	----+--------+--------+--------+--------+----* GCTGGTCTGTTTCTCCTTATTTGAGCCACCCTGAAGGTATGGTCATTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	149349289	149591519	25	99.5	Internal No-hit

Length: 999 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60282	100.0	Kinesin heavy c...	Homo sapiens
AAH67051	98.2	Kinesin family ...	Mus musculus
BAE34712	98.1	unnamed protein...	Mus musculus
XP_001790004	98.4	kinesin family ...	Bos taurus
EDM00464	98.2	kinesin family ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002357	1.7e-20	35.2	KIAA0359
AB037826	3.4e-18	28.8	KIAA1405
AB040881	4.3e-12	28.5	KIAA1448
AB011163	1.3e-11	28.4	KIAA0591
AB014539	2.8e-11	29.7	KIAA0639

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	119	140	PR00380	Kinesin
	IPR001752	238	255	PR00380	Kinesin
	IPR001752	269	287	PR00380	Kinesin
	IPR001752	319	340	PR00380	Kinesin
HMMPfam	IPR001752	56	370	PF00225	Kinesin
HMMSmart	IPR001752	48	377	SM00129	Kinesin
ProfileScan	IPR001752	47	299	PS50067	Kinesin
ScanRegExp	IPR001752	268	279	PS00411	Kinesin

Primer_f	TGATATAAACCACCATTCTCC
Primer_r	GTGTGTTCTCTGGGCTTTATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGATATAAACCACCATTCTCC
Primer_r	GTGTGTTCTCTGGGCTTTATG
PCR product length	104 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles