Order Kazusa clone(s) from : ![]() |
Product ID | ORK01984 |
---|---|
Accession No | AB011177 |
Description | ADAMTS-like 2, transcript variant 1 |
Clone name | hg03238a |
Vector information | |
cDNA sequence | DNA sequence (4067 bp) Predicted protein sequence (1031 aa) |
HaloTag ORF Clone |
FHC01984
![]() |
Flexi ORF Clone | FXC01984 |
Source | Human adult brain |
Rouge ID |
mKIAA0605
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 654 bp |
---|---|
Genome contig ID | gi89161216f_135287440 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (143023 - 143072) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 135387107 | 135430461 | 19 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR013273 | 136 | 154 | PR01857 | Peptidase M12B |
IPR013273 | 254 | 273 | PR01857 | Peptidase M12B | |
IPR013273 | 274 | 293 | PR01857 | Peptidase M12B | |
HMMPfam | IPR000884 | 131 | 185 | PF00090 | Thrombospondin |
IPR010294 | 294 | 411 | PF05986 | ADAM-TS Spacer 1 | |
IPR000884 | 706 | 765 | PF00090 | Thrombospondin | |
IPR000884 | 819 | 874 | PF00090 | Thrombospondin | |
IPR000884 | 939 | 960 | PF00090 | Thrombospondin | |
IPR010909 | 995 | 1028 | PF08686 | PLAC | |
HMMSmart | IPR000884 | 130 | 186 | SM00209 | Thrombospondin |
IPR000884 | 647 | 703 | SM00209 | Thrombospondin | |
IPR000884 | 705 | 766 | SM00209 | Thrombospondin | |
IPR000884 | 768 | 818 | SM00209 | Thrombospondin | |
IPR000884 | 821 | 870 | SM00209 | Thrombospondin | |
IPR000884 | 877 | 935 | SM00209 | Thrombospondin | |
IPR000884 | 937 | 988 | SM00209 | Thrombospondin | |
ProfileScan | IPR000884 | 127 | 186 | PS50092 | Thrombospondin |
IPR000884 | 702 | 766 | PS50092 | Thrombospondin | |
IPR000884 | 817 | 875 | PS50092 | Thrombospondin | |
IPR000884 | 933 | 988 | PS50092 | Thrombospondin | |
IPR010909 | 992 | 1030 | PS50900 | PLAC |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 60 | TLVIWKRIGAGLVVTVALLPRM | 81 | SECONDARY | 22 | 2 | 90 | WAWFLLVLAVVAGDTVSTGST | 110 | PRIMARY | 21 |
---|
![]() |
---|
Primer_f | CTAAGAGACGTGGCACTGAGC |
---|---|
Primer_r | ACAAACACAGGATCCACGCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTAAGAGACGTGGCACTGAGC |
Primer_r | ACAAACACAGGATCCACGCAG |
PCR product length | 165 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |