KIAA0605

Product ID	ORK01984
Accession No	AB011177
Description	ADAMTS-like 2, transcript variant 1
Clone name	hg03238a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4067 bp) Predicted protein sequence (1031 aa)
HaloTag ORF Clone	FHC01984
Flexi ORF Clone	FXC01984
Source	Human adult brain
Rouge ID	mKIAA0605 by Kazusa Mouse cDNA Project

Length: 4067 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	654 bp
Genome contig ID	gi89161216f_135287440
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ATCTACGTTAATAAAGTGGTCCTATTTATGGCGGC
Flanking genome sequence (143023 - 143072)	----+--------+--------+--------+--------+----* ATCATGGGGTCTCAGTTGCCTCTGGCTGGAGAAGTGGGTGGCCTGGGGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	135387107	135430461	19	99.8	Perfect prediction

Length: 1031 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM24586	99.8	ADAMTS-like 2 [...	Homo sapiens
XP_001169765	97.8	ADAMTS-like 2 i...	Pan troglodytes
BAG72447	100.0	ADAMTS-like 2 [...	synthetic construct
EAW88095	99.9	ADAMTS-like 2, ...	Homo sapiens
Q86TH1	99.8	ADAMTS-like pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095949	2.9e-30	25.0	KIAA2029
AB002364	8.9e-25	25.1	KIAA0366
AB014588	1.4e-22	33.9	KIAA0688
AB037767	2.1e-22	29.9	KIAA1346
AB033059	2.1e-21	32.7	KIAA1233

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	136	154	PR01857	Peptidase M12B
	IPR013273	254	273	PR01857	Peptidase M12B
	IPR013273	274	293	PR01857	Peptidase M12B
HMMPfam	IPR000884	131	185	PF00090	Thrombospondin
	IPR010294	294	411	PF05986	ADAM-TS Spacer 1
	IPR000884	706	765	PF00090	Thrombospondin
	IPR000884	819	874	PF00090	Thrombospondin
	IPR000884	939	960	PF00090	Thrombospondin
	IPR010909	995	1028	PF08686	PLAC
HMMSmart	IPR000884	130	186	SM00209	Thrombospondin
	IPR000884	647	703	SM00209	Thrombospondin
	IPR000884	705	766	SM00209	Thrombospondin
	IPR000884	768	818	SM00209	Thrombospondin
	IPR000884	821	870	SM00209	Thrombospondin
	IPR000884	877	935	SM00209	Thrombospondin
	IPR000884	937	988	SM00209	Thrombospondin
ProfileScan	IPR000884	127	186	PS50092	Thrombospondin
	IPR000884	702	766	PS50092	Thrombospondin
	IPR000884	817	875	PS50092	Thrombospondin
	IPR000884	933	988	PS50092	Thrombospondin
	IPR010909	992	1030	PS50900	PLAC

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	60	TLVIWKRIGAGLVVTVALLPRM	81	SECONDARY	22
SOSUI2	2	90	WAWFLLVLAVVAGDTVSTGST	110	PRIMARY	21

Primer_f	CTAAGAGACGTGGCACTGAGC
Primer_r	ACAAACACAGGATCCACGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTAAGAGACGTGGCACTGAGC
Primer_r	ACAAACACAGGATCCACGCAG
PCR product length	165 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles